We narrowed to 3,342 results for: cmv promoter
-
Plasmid#31093DepositorInsertHNF4A (HNF4A Human)
UseFlp/frtTagsmycExpressionMammalianMutationsplice variant 8 of HNF4A, deletion of CMV promo…Available SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
CMV-68_HNF4A2
Plasmid#31092DepositorInsertHNF4A (HNF4A Human)
UseFlp/frtTagsmycExpressionMammalianMutationsplice variant 2 of HNF4A, deletion of CMV promo…Available SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
CMV-138_HNF4A2
Plasmid#31091DepositorInsertHNF4A (HNF4A Human)
UseFlp/frtTagsmycExpressionMammalianMutationsplice variant 2 of HNF4A, deletion of CMV promo…Available SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
EW267 CMV-TO-ADAR2dd(E488Q, T501A)-PUF-9R-MARIAcomp(V241D, H243M) (FLP-IN)
Plasmid#236127PurposePlasmid encoding ADAR2dd attached to PUF-9R with deimmunizing mutations under control of CMV promoter with two TetR binding sitesDepositorInsertADAR2dd-PUF-9R (ADARB1 Human, Synthetic)
ExpressionMammalianMutationE488Q, T501A in ADAR2dd; V241D, H243M in PUF-9RPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-PtenK13E/K289E-Puro
Plasmid#135681PurposeConstitutive expression (cMV promoter) of K13E/K289E mutant Pten cDNA, Puromycin selectionDepositorAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMV-Blast
Plasmid#125133PurposeLentiviral empty backbone control vector with CMV promoter and Blasticidin resistance geneDepositorTypeEmpty backboneUseLentiviralAvailable SinceMay 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCCl-MCS_miniCMV_EGFP
Plasmid#134984PurposeThe plasmid includes a EGFP gene driven by a minimal CMV promoter. Cis-regulatory elements can be cloned into the single EcoRV site. This plasmid can be used for generating a lentiviral vectorDepositorInsertEGFP
UseLentiviralPromoterminCMVAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHCMV_SARS-CoV_S
Plasmid#207306PurposeMammalian expression of Human SARS coronavirus S proteinDepositorInsertSARS-CoV_S (S Human SARS coronavirus)
ExpressionMammalianMutationmammalian codon optimizationPromoterCMV promoterAvailable SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCCl-MCS_miniCMV_miRFP703
Plasmid#134985PurposeThe plasmid includes a miRFP703 gene driven by a minimal CMV promoter. Cis-regulatory elements can be cloned into the single EcoRV site. This plasmid can be used for generating a lentiviral vectorDepositorInsertmiRFP703
UseLentiviralPromoterminCMVAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCCl-MCS_miniCMV_TagBFP
Plasmid#134986PurposeThe plasmid includes a TagBFP gene driven by a minimal CMV promoter. Cis-regulatory elements can be cloned into the single EcoRV site. This plasmid can be used for generating a lentiviral vectorDepositorInsertTagBFP
UseLentiviralPromoterminCMVAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV_mCherry_2A_HA_2xMS2-VP64
Plasmid#68419PurposeTransient expression of humanized MS2 (V75E/A81G), fused to the VP64 transcrption activator, in mammalian cells, under a CMV promoterDepositorInsertMS2
UseSynthetic BiologyTagsHA and VP64ExpressionMammalianMutationMS2: V75E/A81GPromoterCMVAvailable SinceSept. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
lvl0-P-CMV
Plasmid#229165Purposelvl 0 promoterDepositorInsertCMV
UseSynthetic BiologyAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-iRFP670-24xMS2
Plasmid#238915PurposeContains miniCMV promoter expressing iRFP670 mRNA taged 24xMS2 motifDepositorInsertiRFP670-24xMS2
UseLentiviralExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHCMV-VSVgSS-15F11-TM
Plasmid#207317PurposeFunctional incorporation of 15F11 scFv (anti-HA) into envelope of virionsDepositorInsert15F11 ScFv
ExpressionMammalianPromoterCMV promoterAvailable SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
MXS_CMV::rtTA3-bGHpA
Plasmid#62445PurposeMXS_chaining vector with CMV::rtTA3-bGHpADepositorInsertcassette containing the reverse tetracycline transactivator with CMV promoter
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
CMV-dCasRx-ccdB
Plasmid#221003PurposeDestination vector for Gateway cloning of ORFs into the C-terminus of dCasRx. CMV promoter. Transient expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
MXS_CMV::ZeoR-bGHpA
Plasmid#62441PurposeMXS_chaining vector with CMV::ZeoR-bGHpADepositorInsertresistance cassette against Zeocin with CMV Promoter
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
MXS_CMV::PuroR-bGHpA
Plasmid#62439PurposeMXS_chaining vector with CMV::PuroR-bGHpADepositorInsertresistance cassette against Puromycin with CMV Promoter
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
MXS_CMV::HygroR-bGHpA
Plasmid#62435PurposeMXS_chaining vector with CMV::HygroR-bGHpADepositorInsertresistance cassette against hygromycin B with CMV Promoter
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
MXS_CMV::CreERT2-bGHpA
Plasmid#62443PurposeMXS_chaining vector with CMV::CreERT2-bGHpADepositorInsertcassette containing the tamoxifen inducible Cre recombinase with CMV Promoter
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only