We narrowed to 4,562 results for: TIL

#206222

For expressing cloned exons as circular RNA. Alternatively, for expressing cDNA (if the EcoRI-XhoI restriction fragment is also removed).

Simon Conn, Brett Stringer

Stringer et al bioRxiv. 2023 Nov 22:2023.11.21.568171.

Aug. 31, 2023

Academic Institutions and Nonprofits only

#206216

For expressing cloned exons as circular RNA. Alternatively, for expressing cDNA (if the EcoRI-XhoI restriction fragment is also removed).

Simon Conn, Brett Stringer

Stringer et al bioRxiv. 2023 Nov 22:2023.11.21.568171.

Aug. 31, 2023

Academic Institutions and Nonprofits only

#197736

Phytobrick (MoClo) Level 0 Part

Daniel Voytas

Chamness et al Plant Genome. 2023 Mar 9:e20312. doi: 10

May 11, 2023

Academic Institutions and Nonprofits only

#169571

Tier-1 vector encoding PhCMV-driven KRAB transsilencer domain (PhCMV-KRAB-pA).

Martin Fussenegger

Haellman et al Metab Eng. 2021 Jul;66:41-50. doi: 10.10

Sept. 19, 2022

Academic Institutions and Nonprofits only

#169639

Tier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-PuroR-pA-3'ITR)

Martin Fussenegger

Haellman et al Metab Eng. 2021 Jul;66:41-50. doi: 10.10

July 13, 2022

Academic Institutions and Nonprofits only

#169630

pX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.

Martin Fussenegger

Haellman et al Metab Eng. 2021 Jul;66:41-50. doi: 10.10

July 13, 2022

Academic Institutions and Nonprofits only

#169619

Tier-2 vector encoding PPGK-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 (A1-pA::A2-pA::PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA).

Martin Fussenegger

Haellman et al Metab Eng. 2021 Jul;66:41-50. doi: 10.10

July 12, 2022

Academic Institutions and Nonprofits only

#169564

Tier-1 vector encoding PVanO2-driven SEAP expression (OVanO2-PCMVmin-2-SEAP-pA).

Martin Fussenegger

Haellman et al Metab Eng. 2021 Jul;66:41-50. doi: 10.10

July 12, 2022

Academic Institutions and Nonprofits only