We narrowed to 19,374 results for: INO
-
Plasmid#137726PurposeGateway vector for inducible stem loop RNAi in T.b. brucei 2T1DepositorTypeEmpty backboneUseRNAi; Trypanosoma brucei tet inducible stem loopAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only
-
VPS13D(∆ATG2-C/PH)^EGFP
Plasmid#194004PurposeDeletion of DHPH domain of VPS13DDepositorInsertCodon optimized VPS13D (VPS13D Human)
TagsEGFPExpressionMammalianMutationearly stop codon before DHPHAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWT35S-VC155
Plasmid#194051PurposeTransient expression of VN155 (mVenus β-strands 8 to 11, amino acids 155−239) in plant cell (Cytosol)DepositorInsertVC155 (mVenus β-strands 8 to 11, amino acids 155−239)
ExpressionPlantPromoterCaMV 35S promoterAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWT35S-VN154
Plasmid#194050PurposeTransient expression of VN154 (mVenus β-strands 1 to 7, amino acids 1−154) in plant cell (Cytosol)DepositorInsertVN154 (mVenus β-strands 1 to 7, amino acids 1−154)
ExpressionPlantPromoterCaMV 35S promoterAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUPD2_SulR(CDS)
Plasmid#186423Purposeprovides sulfadiazine resistance (sulI) as a level 0 GoldenBraid part (CDS; B3-B4-B5)DepositorInsertSulR
UseSynthetic Biology; Cds (part b3-b4-b5), goldenbra…ExpressionPlantMutationBsaI and BsmBI sites removedAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
CMV:AsCpf1-2A-GFP-U6-INS-sg
Plasmid#194719PurposeBicistronic vector expressing CMV promoter driven AsCpf1, and U6 promoter driven guide RNA that target hINSDepositorArticleAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-EF
Plasmid#177267PurposeCRISPR vectorDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTL359
Plasmid#168420PurposepGBKT7 yeast two-hybrid plasmidDepositorInsertOsaHIP41
ExpressionYeastAvailable SinceNov. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLZRS-panTRK-CR1-EGFP
Plasmid#187194PurposeTo express a hybrid Trk receptor tagged with EGFP. This Hybrid TRK receptor was designed to bind NGF, BDNF and NT-3DepositorInsertCR1 pan-TRK receptor
UseRetroviralTagsEGFPExpressionMammalianPromotermo-MLV or MMLVAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNL(CMV)Rep78-III/CMV/WPREΔU3
Plasmid#190726PurposeExpression of AAV2 Rep78-III in mammalian cellsDepositorInsertAAV2 Rep78-III
UseLentiviralExpressionMammalianPromoterCMV-IEAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
OA-1127B
Plasmid#190997PurposeExpresses arrays of gRNA targeting rel1 promoter under U6b/c promoterDepositorInsertU6b:sgRNArel1A1 - U6c:sgRNArel1A2 - U6b:sgRNArel1A3 - U6c:sgRNArel1A4
ExpressionInsectAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB556
Plasmid#185108Purpose1st 200 amino acids (N-term + transmembrane domain) of Pom152 fused to HA and GFP with S158A, F159A, F160ADepositorInsertPOM152
TagsGFPExpressionYeastMutation1st 200 amino acids (N-term + transmembrane domai…Available SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB553
Plasmid#185107Purpose1st 200 amino acids (N-term + transmembrane domain) of Pom152 fused to HA and GFP with Y180L, Q182LDepositorInsertPOM152
TagsGFPExpressionYeastMutation1st 200 amino acids (N-term + transmembrane domai…Available SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTL335
Plasmid#168397PurposepGBKT7 yeast two-hybrid plasmidDepositorInsertOsaHIP24
ExpressionYeastAvailable SinceAug. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTL336
Plasmid#168396PurposepGBKT7 yeast two-hybrid plasmidDepositorInsertOsaHIP34
ExpressionYeastAvailable SinceAug. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
p8291 MSCV-Neo C-HA 18E7 ΔDLLC
Plasmid#184523PurposeExpression of HPV18 E7 ΔDLLCDepositorInsertHPV18 E7 ΔDLLC
UseRetroviralTagsHAMutationdeletion of DLLCPromoterMSCV LTRAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-FluoSTEP-AKAR (mScarlet-I)
Plasmid#181861PurposeFluoSTEP-AKAR using mScarlet-I as the FRET acceptor.DepositorInsertFluoSTEP-AKAR (mScarlet-I)
TagsmScarlet-I and sfGFP(1-10)ExpressionMammalianPromoterCMVAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTL95
Plasmid#168329PurposepGBKT7 yeast two-hybrid plasmidDepositorInsertSi514802025
ExpressionYeastAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTL316
Plasmid#168377PurposepGBKT7 yeast two-hybrid plasmidDepositorInsertLOC_ Os08g40130
ExpressionYeastAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only