We narrowed to 7,609 results for: Pol
-
Plasmid#40561DepositorInsertLRRK2
UseBaculovirusTags6xHis and GSTMutationWTPromoterpolHAvailable SinceOct. 1, 2012AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBACgus N-His/GST
Plasmid#40399DepositorInsertGST
UseBaculovirusTagsHisTevMutationWTPromoterpolHAvailable SinceOct. 1, 2012AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMpGWBhis03-Citrine-NLS
Plasmid#188558PurposeBinary vector for the expression of Citrine-NLS with MpIGPDm selective marker in Marchantia polymorpha (igpd mutants) .DepositorInsertCitrine-NLS and MpIGPDm
UseCRISPR and Gateway CloningAvailable SinceMay 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPS3911
Plasmid#113330Purposecontrol for Hermes transposition; TIR-flanked LEU2, transposase absentDepositorInsertbeta-isopropyl malate dehydrogenase
ExpressionYeastAvailable SinceAug. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZB604_pT7-sfGFP
Plasmid#228510PurposeBacterial Hybrid Reporter Plasmid (sfGFP), pT7-sfGFPDepositorInsertsfGFP
UseSynthetic BiologyPromoterT7Available SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
MGS0156_pET29b
Plasmid#215410PurposeExpression construct for MGS0156 gene, codon optimized for expression in E. coliDepositorInsertMGS0156
ExpressionBacterialAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
GatA_pET29b
Plasmid#215406PurposeExpression construct for GatA gene, codon optimized for expression in E. coliDepositorInsertGatA
ExpressionBacterialAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCsB
Plasmid#136068PurposeAcceptor plasmid for even level position 2, lacZ blue-white screeningDepositorInsertlacZ
UseSynthetic BiologyExpressionPlantAvailable SinceNov. 30, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCsC
Plasmid#136069PurposeAcceptor plasmid for even level position 3, lacZ blue-white screeningDepositorInsertlacZ
UseSynthetic BiologyExpressionPlantAvailable SinceNov. 30, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCsE
Plasmid#136070PurposeAcceptor plasmid for even level position 4, lacZ blue-white screeningDepositorInsertlacZ
UseSynthetic BiologyExpressionPlantAvailable SinceNov. 30, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pST50Trc4-HPCHISNDHFR
Plasmid#64002PurposePosition 4 transfer plasmid for pST44 polycistronic plasmid suite; N-term cleavable double tag; contains DHFR gene in BamHI-NgoMIV cassette as positive controlDepositorTypeEmpty backboneTags6xHis & Protein C (HPC); TEV cleavableExpressionBacterialPromoterT7Available SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pST50Trc1-STRHISNDHFR
Plasmid#63946PurposePosition 1 transfer plasmid for pST44 polycistronic plasmid suite; N-term cleavable double tag; contains DHFR gene in BamHI-NgoMIV cassette as positive controlDepositorTypeEmpty backboneTags6xHis & Strep II (STR); TEV cleavableExpressionBacterialPromoterT7Available SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pST50Trc2-HPCHISNDHFR
Plasmid#63966PurposePosition 2 transfer plasmid for pST44 polycistronic plasmid suite; N-term cleavable double tag; contains DHFR gene in BamHI-NgoMIV cassette as positive controlDepositorTypeEmpty backboneTags6xHis & Protein C (HPC); TEV cleavableExpressionBacterialPromoterT7Available SinceOct. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
Abr in pAcG2T
Plasmid#38162DepositorAvailable SinceAug. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCfb12567
Plasmid#219927PurposePrCYC with the overhangs for SapI restriction site can be insert into the base plasmid of TUNEYALIDepositorInsertPromoter CYC
ExpressionYeastAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCfb12566
Plasmid#219926PurposePrDGA with the overhangs for SapI restriction site can be insert into the base plasmid of TUNEYALIDepositorInsertPromoter DGA
ExpressionYeastAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCfb12622
Plasmid#219929PurposePrACT with the overhangs for SapI restriction site can be insert into the base plasmid of TUNEYALIDepositorInsertPromoter ACT
ExpressionYeastAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb12562
Plasmid#219923PurposePrGPD with the overhangs for SapI restriction site can be insert into the base plasmid of TUNEYALIDepositorInsertPromoter GPD
ExpressionYeastAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13186
Plasmid#219924PurposePrTEF with the overhangs for SapI restriction site can be insert into the base plasmid of TUNEYALIDepositorInsertPromoter TEF
ExpressionYeastAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only