We narrowed to 7,773 results for: aav
-
Plasmid#221605PurposeA recombinant AAV2 plasmid encoding the light insensitive PiGM-Iq system with CRY2PHR(D387A), CIBN and mCherry as expression marker. hSynapsin promoter for panneuronal expression.DepositorInsertPiGM-Iq (D387A, mCherry)
UseAAVMutationRGS2 1-53 truncation, CRYPHR D387APromoterHuman SynapsinAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-PiGM-Iq(D387A eGFP)
Plasmid#221603PurposeA recombinant AAV2 plasmid encoding the light insensitive PiGM-Iq system with CRY2PHR(D387A), CIBN and EGFP as expression marker. hSynapsin promoter for panneuronal expression.DepositorInsertPiGM-Iq (D387A, eGFP)
UseAAVMutationRGS2 1-53 truncation, CRYPHR D387APromoterHuman SynapsinAvailable SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-FlpOn-CreOff-MCS-P2A-mCherry
Plasmid#176277PurposeViral vector for co-expression of a CDS of interest and mCherry in cells expressing Flp AND NOT Cre driven by a Synapsin promoter. Contains an in-frame P2A sequence and an MCS for cloning of the CDS.DepositorInsertMCS-P2A-mCherry
UseAAV and Cre/LoxExpressionMammalianPromoterhuman Synapsin IAvailable SinceDec. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pM148: pAAV.CMV-Cas13e-NT sgRNA
Plasmid#203446PurposePlasmid expressing active RfxCas13d with non-targeting gRNADepositorInsertsU6-non targeting (NT) sgRNA
Cas13e
UseAAVTagsHA and NLSExpressionMammalianPromoterCMV and U6Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc CB6PI Gpluc7XmiR-122T
Plasmid#35647DepositorInsert7 bulged miR-122 target sites
UseAAVPromoterCBAvailable SinceJuly 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
AAV C-terminus ABE8e-V106W targeting Pex1-G844D
Plasmid#247655PurposeAAV genome encoding the C-terminus of ABE8e-V106W editor and Sp sgRNA cassetteDepositorInsertC-terminus ABE8e-V106W editor and Pex1-G844D-targeting sgRNA
UseAAV and CRISPRPromoterCBhAvailable SinceApril 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV N-terminus ABE8e-V106W targeting Pex1-G844D
Plasmid#247654PurposeAAV genome encoding the N-terminus of ABE8e-V106W editor and Sp sgRNA cassetteDepositorInsertN-terminus ABE8e-V106W editor and Pex1-G844D-targeting sgRNA
UseAAV and CRISPRPromoterCBhAvailable SinceApril 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-NES-SomaKGECO1
Plasmid#232839PurposeAAV transfer plasmid for Syn-mediated expression of soma-targeted KGECO1DepositorInsertNES-SomaKGECO1
UseAAVTagsnuclear export sequenceExpressionMammalianPromoterSynAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD5-ChR2-YFP
Plasmid#178722PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of ChR2-YFP in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertChR2-YFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD6-ChR2-YFP
Plasmid#178723PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of ChR2-YFP in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertChR2-YFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4-ChR2-YFP
Plasmid#178724PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of ChR2-YFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertChR2-YFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS6-ChR2-YFP
Plasmid#178726PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of ChR2-YFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertChR2-YFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD6-V5-APEX2-NES
Plasmid#178700PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of V5-APEX2-NES in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertV5-APEX2-NES
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4-V5-APEX2-NES
Plasmid#178704PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of V5-APEX2-NES in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertV5-APEX2-NES
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD4-V5-APEX2-NES
Plasmid#178698PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of V5-APEX2-NES in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertV5-APEX2-NES
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD5-V5-APEX2-NES
Plasmid#178699PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of V5-APEX2-NES in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertV5-APEX2-NES
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-FLEX-SomaGCaMP7
Plasmid#182941PurposeCre-dependent expression of cell body-targeted GCaMP7f, under EF1a promoter. As bright as conventional GCaMP7f.DepositorInsertSoma-GCaMP7
UseAAVAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn1_HyPer7_cyto
Plasmid#238967PurposeMammalian neurons HyPer7 expressionDepositorInsertHyPer7
UseAAVExpressionMammalianPromoterhSyn1Available SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_GFAP_HyPer7_mito
Plasmid#238966PurposeMammalian astrocytes HyPer7 expression targeted to the mitochondrial matrixDepositorInsertHyPer7
UseAAVTags3x Cytochrome C Oxidase Subunit VIII presequenseExpressionMammalianPromoterGFAPAvailable SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only