We narrowed to 6,116 results for: KIT
-
Plasmid#247594PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsert3xHA
UseUnspecifiedPromoterread throughAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNK7190
Plasmid#219763PurposeMoClo-compatible Level M for expression nnLuz, nnH3H, nnCPH in plants (N.benthamiana, BY2 cells)DepositorInsertnnLuz, nnH3H, nnCPH
ExpressionPlantAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOTvGPI(EP)-blast-mNG
Plasmid#221051PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmNeonGreen
UseUnspecifiedPromoterread throughAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMMK201
Plasmid#207131PurposeType 2 ptac promoter partDepositorInsertptac promoter
ExpressionBacterialAvailable SinceApril 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM042_P15678_MultiGeneBackbone
Plasmid#216467PurposeEmpty integration vector for genomic integration for multigene into S. pombe. Targets Ura4 locus. Part type 15678 following the YeastToolkit MoClo grammar. Contains GFP drop out.DepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM041_P15678_SingleGeneBackbone
Plasmid#216466PurposeEmpty integration vector for genomic integration of 1 transcriptional unit into S. pombe. Targets Ura4 locus. Part type 15678 following the YeastToolkit MoClo grammar. Contains GFP drop out.DepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS161
Plasmid#215683PurposeGuide only plasmid targeting chrIII split hygromycinR landing padDepositorInsertU6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRA106
Plasmid#209339PurposeGateway cloning compatible binary vector for agrobacterium mediated transformation. Arabidopsis UBQ10 promoter expression of N-terminal moxMaple fusion protein.DepositorTypeEmpty backboneExpressionPlantAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-blast-moxNG
Plasmid#190222PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmoxNeonGreen
UseUnspecifiedPromoterread throughAvailable SinceSept. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJMC-5-Esp3I
Plasmid#197836PurposeLevel 1 module 5 with Esp3I expansion pointDepositorInsertNone
UseUnspecifiedAvailable SinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-blast-Ppyr9eh
Plasmid#201443PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertPpyr9eh
UseUnspecifiedPromoterread throughAvailable SinceJuly 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-blast-mNG:Ppyr9eh
Plasmid#201441PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmNG:Ppyr9eh
UseUnspecifiedPromoterread throughAvailable SinceJuly 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPOTv6-g418-His:mScarletI:His
Plasmid#201098PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmScarlet-I
UseUnspecifiedPromoterread throughAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPOTv6-g418-His:mNG:His
Plasmid#201095PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmNeonGreen
UseUnspecifiedPromoterread throughAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-g418-tagRFPt
Plasmid#201085PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInserttagRFPt
UseUnspecifiedPromoterread throughAvailable SinceJuly 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-hygro-tagRFPt
Plasmid#201084PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInserttagRFPt
UseUnspecifiedPromoterread throughAvailable SinceJuly 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJMC-3-Esp3I
Plasmid#197832PurposeLevel 1 module 3 with Esp3I expansion pointDepositorInsertNone
UseUnspecifiedAvailable SinceMay 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJMC-3-BsaI
Plasmid#197820PurposeLevel 1 module 3 with BsaI expansion pointDepositorInsertNone
UseUnspecifiedAvailable SinceMay 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJMC-5-BsaI
Plasmid#197824PurposeLevel 1 module 5 with BsaI expansion pointDepositorInsertNone
UseUnspecifiedAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJMC-1-BsaI
Plasmid#197816PurposeLevel 1 module 1 with BsaI expansion pointDepositorInsertNone
UseUnspecifiedAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only