We narrowed to 11,122 results for: ARIA;
-
Plasmid#159686PurposeMammalian protein expression of NRAS HVR (Hypervariable region)-Halotag fusionDepositorInsertHalotag-NRasHVR (NRAS Human)
UseTagsHalotagExpressionMammalianMutationPromoterAvailable sinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-BA.2-AVI
Plasmid#184532PurposeExpresses SARS-CoV-2 NTD domain from the BA.2 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD-BA.2 (S )
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationT19I, L24-, P25-, P26-, A27S, G142D, V213GPromoterAvailable sinceMay 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-B.1.351-AVI
Plasmid#176326PurposeExpresses SARS-CoV-2 S2P protein from the B.1.351 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P-B.1.351 (S )
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationL18F, D80A, D215G, 242-244del, R246I, K417N, E484…PromoterAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-P.1-AVI
Plasmid#176429PurposeExpresses SARS-CoV-2 NTD domain from the P.1 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD-P.1 (S )
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationL18F, T20N, P26S, D138Y, R190SPromoterAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-P.1-AVI
Plasmid#176327PurposeExpresses SARS-CoV-2 S2P protein from the P.1 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P-P.1 (S )
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationL18F, T20N, P26S, D138Y, R190S, K417T, E484K, N50…PromoterAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-B.1.351
Plasmid#171749PurposeMammalian expression of SARS-CoV-2 Spike protein S-GSAS-D614G-B.1.351 variant (South African)DepositorInsertSpike (S-GSAS-B.1.351 variant) (S Severe acute respiratory syndrome coronavirus 2)
UseTagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable sinceJuly 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-BJ.1-AVI
Plasmid#196617PurposeExpresses SARS-CoV-2 RBD protein from the BJ.1 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-BJ.1
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationG339H, R346T, L368I, S371F, S373P, S375F, T376A, …PromoterAvailable sinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-SD1-C.37-AVI
Plasmid#181702PurposeExpresses SARS-CoV-2 RBD-SD1 domain from the C.37 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-SD1-C.37 (S )
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationL452Q, F490SPromoterAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-SD1-B.1.621-AVI
Plasmid#181703PurposeExpresses SARS-CoV-2 RBD-SD1 domain from the B.1.621 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-SD1-B.1.621 (S )
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationR346K, E484K, N501YPromoterAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-B.1.621-AVI
Plasmid#181694PurposeExpresses SARS-CoV-2 S2P protein from the B.1.621 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P-B.1.621 (S )
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationT95I, insert144T, Y144S, Y145N, R346K, E484K, N50…PromoterAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-C.37-AVI
Plasmid#181696PurposeExpresses SARS-CoV-2 NTD domain from the C.37 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD-C.37 (S )
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationG75V, T76I, R246N, ∆S247-∆D253,PromoterAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-B.1.621-AVI
Plasmid#181697PurposeExpresses SARS-CoV-2 NTD domain from the B.1.621 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD-B.1.621 (S )
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationT95I, insert144T, Y144S, Y145NPromoterAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-C.37-AVI
Plasmid#181699PurposeExpresses SARS-CoV-2 RBD domain from the C.37 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-C.37 (S )
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationL452Q, F490SPromoterAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-B.1.621-AVI
Plasmid#181700PurposeExpresses SARS-CoV-2 RBD domain from the B.1.621 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-B.1.621 (S )
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationR346K, E484K, N501YPromoterAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-C.37-AVI
Plasmid#181693PurposeExpresses SARS-CoV-2 S2P protein from the C.37 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P-C.37 (S )
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationG75V, T76I, R246N, ∆S247-∆D253, L452Q, F490S, D61…PromoterAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-B.1.617.1-AVI
Plasmid#176435PurposeExpresses SARS-CoV-2 NTD domain from the B.1.617.1 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD-B.1.617.1 (S )
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationT95I, G142D, E154KPromoterAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-B.1.617.2-AVI
Plasmid#176436PurposeExpresses SARS-CoV-2 NTD domain from the B.1.617.2 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD-B.1.617.2 (S )
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationT19R, G142D, E156del, F157del, R158GPromoterAvailable sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only