We narrowed to 2,565 results for: organization Addgene
-
Plasmid#207353PurposeLentiviral transfer plasmid containing CMV-driven expression cassette encoding PEmax enzyme for prime editing.DepositorInsertPrime editor max (PEmax) enzyme
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1a-hDNAJC6-T2A-copGFP
Plasmid#170443PurposeLentiviral vector expressing human DNAJC6 with copGFP reporter gene, under control of EF1alpha promoterDepositorAvailable SinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN4-ires-puro
Plasmid#167828PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorInsertEKAREN4
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPB CAG SMARCA4-IRES-EGFP
Plasmid#153948PurposepiggyBac transposon vector with CAG promoter expressing wild-type SMARCA4 (FLAG-tagged) and EGFPDepositorAvailable SinceAug. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN5-ires-blast
Plasmid#167822PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorInsertEKAREN5
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHR-Fzd4 subtype NGS Wnt
Plasmid#159625PurposeExpress Fzd4 subtype NGS Wnt in mammalian cellsDepositorInsertFzd4 subtype NGS Wnt
UseLentiviralTagsHis tagExpressionMammalianAvailable SinceSept. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
P521_VSX2_p2A-h2b_mRuby3
Plasmid#239104PurposeUsed in CRISPR gene editing to Insert a p2A-h2b_mRuby3 sequence before the stop codon of the endogenous human VSX2 geneDepositorInsertVSX2 (VSX2 Human)
UseCRISPRTags-p2A-h2b-mRuby3ExpressionMammalianPromoterEndogenous VSX2 promoterAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
RKS-Fzd8 subtype NGS Wnt
Plasmid#159627PurposeExpress Fzd8 subtype NGS Wnt in mammalian cellsDepositorInsertFzd8 subtype NGS Wnt
UseLentiviralTagsHis tagExpressionMammalianAvailable SinceSept. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-PE2-IRES-ZeoR
Plasmid#207352PurposeLentiviral transfer plasmid containing CMV-driven expression cassette encoding PE2 enzyme for prime editing.DepositorInsertPrime editor 2 (PE2) enzyme
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only