We narrowed to 5,484 results for: crispr cas9 grna plasmid
-
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAEF5
Plasmid#136305PurposePlasmid encoding the Cas9 gene and a gRNA expression cassette allowing to clone a single or multiple gRNAs for DSBs induction in yeast. Constructed by Aubin FleissDepositorTypeEmpty backboneUseCRISPRAvailable SinceFeb. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGTR
Plasmid#63143PurposePCR template to construct polycistronic tRNA-gRNADepositorInsertgRNA-tRNA fusion
UseCRISPR and Synthetic BiologyAvailable SinceApril 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJA58
Plasmid#59933PurposegRNA for cleavage at dpy-10(cn64) locus in C elegansDepositorInsertdpy-10(cn64) gRNA
UseCRISPRPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJA42
Plasmid#59930PurposegRNA for cleavage at rol-6(su1006) locus in C elegansDepositorInsertrol-6(su1006) gRNA
UseCRISPRPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJA50
Plasmid#59931PurposegRNA for cleavage at unc-58(e665) locus in C elegansDepositorInsertunc-58(e665) gRNA
UseCRISPRPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJA59
Plasmid#59932PurposegRNA for cleavage at unc-109(n499) locus in C elegansDepositorInsertunc-109(n499) gRNA
UseCRISPRPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJA14
Plasmid#59929PurposegRNA for cleavage at rde-1(H974) locus in C elegansDepositorInsertrde-1(H974) gRNA
UseCRISPRPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only