We narrowed to 2,562 results for: neurod
-
Plasmid#171485Purposetransfer plasmid for lentiviral vector production expressing Hs ATP13A2 WTDepositorAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only
-
lucMAPT-30D
Plasmid#214672PurposeMAPT Exon 10 reporter containing the MS2 hairpin 30 base pairs downstream of the 5′ splice siteDepositorInsertMAPT (MAPT Human)
TagsFirefly Luciferase, Renilla Luciferase, and V5ExpressionMammalianMutationContains Exon 9, Exon 10 with a mutation to intro…PromoterCMVAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
lucMAPT-30U
Plasmid#214673PurposeMAPT Exon 10 reporter containing the MS2 hairpin 30 base pairs upstream of the 3′ splice siteDepositorInsertMAPT (MAPT Human)
TagsFirefly Luciferase, Renilla Luciferase, and V5ExpressionMammalianMutationContains Exon 9, Exon 10 with a mutation to intro…PromoterCMVAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 TDP-43 NLS1 YFP
Plasmid#84912PurposeMammalian expresion of TDP-43 NLS1 YFPDepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFB-EPCP1
Plasmid#226783PurposeExpression of Z-tagged LRRK2 RCKW using BaculovirusesDepositorInsertLeucine-rich repeat kinase 2 (LRRK2 Human)
TagsHis-Z-TEVExpressionInsectMutationAmino acids deleted 1-1326Available SinceNov. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBABE-Tau-nYFP
Plasmid#92204PurposeRetroviral overexpression vector for Tau bimolecular fluorescence complementation (BiFC)DepositorAvailable SinceAug. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti_SIV-(SalI)-syn-IRES-mEmerald-CaV2.1 WPRE
Plasmid#236239PurposeLentiviral expression of voltage-gated calcium channel, CaV2.1, N-terminally tagged with mEmeraldDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBABE-Tau-cYFP
Plasmid#92205PurposeRetroviral overexpression vector for α-Syn/Tau bimolecular fluorescence complementation (BiFC)DepositorAvailable SinceAug. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMVenh synapsin-intron-aSYNUCLEIN A53T
Plasmid#227004PurposeAAV transfer plasmid encoding the human A53T mutant α-SYN under the control of the CMVie enhanced synapsin1 promoterDepositorInsertalpha synuclein A53T mutant (SNCA Synthetic, Human)
UseAAVMutationA53TPromoterCMVenh synapsinAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only