We narrowed to 13,852 results for: OVA
-
Plasmid#105142PurposeYeast gene targetingDepositorInsertkanMX6-P81nmt1-mCFP
Tags81nmt1-mCFPExpressionBacterial and YeastMutationA206KPromoter81nmt1Available SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-kanMX6-P41nmt1-mCFP
Plasmid#105139PurposeYeast gene targetingDepositorInsertkanMX6-P41nmt1-mCFP
Tags41nmt1-mCFPExpressionBacterial and YeastMutationA206KPromoter41nmt1Available SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pESC/CURT_fluoB
Plasmid#117997PurposeExpression of CURT_fluoB controlled by the Gal1 promoterDepositorInsertCURT_fluoB
UseYeast/bacteria binary vectorExpressionYeastPromoterGal1Available SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pBSU6-shTom40.3/CMV-eGFP
Plasmid#89797PurposeExpresses shRNA against TOM40.DepositorInsertshRNA Tom40
TagseGFP under separate promoterExpressionMammalianPromoterU6Available SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
GST-30B
Plasmid#1846DepositorAvailable SinceMay 4, 2005AvailabilityAcademic Institutions and Nonprofits only -
-
GST-30A
Plasmid#1845DepositorAvailable SinceMay 4, 2005AvailabilityAcademic Institutions and Nonprofits only -
hSyn-DIO-PostSynBar-P2A-mCherry
Plasmid#247719PurposeThe set of SynBar constructs used in the optimized connectome-seq experiments.DepositorInsertPostSynBar and mCherry
UseAAVAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYSGDLuc
Plasmid#236297PurposeDual luciferase reporter for measuring recoding efficiencies in yeastDepositorTypeEmpty backboneExpressionYeastPromoterTEF1Available SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF myc-TurboID
Plasmid#245241PurposeProximity-labeling proteomics negative controlDepositorInsertTurboID
ExpressionMammalianMutationwild-typeAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLPo-3xmiR122-WPRE-HGHpA
Plasmid#220938PurposeFLPo recombinaseDepositorInsertCodon-optimized FLPe recombinase
UseAAVAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
dimerTomato-wGBD
Plasmid#129635PurposeVisualization of active Cdc42DepositorInsertCdc42 binding domain of N-WASP
ExpressionMammalianPromoterCMVdelAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM042_P15678_MultiGeneBackbone
Plasmid#216467PurposeEmpty integration vector for genomic integration for multigene into S. pombe. Targets Ura4 locus. Part type 15678 following the YeastToolkit MoClo grammar. Contains GFP drop out.DepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM041_P15678_SingleGeneBackbone
Plasmid#216466PurposeEmpty integration vector for genomic integration of 1 transcriptional unit into S. pombe. Targets Ura4 locus. Part type 15678 following the YeastToolkit MoClo grammar. Contains GFP drop out.DepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only