We narrowed to 4,936 results for: AAT
-
Plasmid#188671PurposeshRNADepositorAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only
-
mU6-sgAmpk1-hU6-sgAmpk2
Plasmid#177224PurposeExpresses Ampk1 and Ampk2 targeting gRNAs and Cre-recombinaseDepositorInsertsgPrkaa1/sgPrkaa2
UseLentiviralPromotermU6/hU6Available SinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
SGEP-sh-Hs-PHGDH-1883
Plasmid#188669PurposeshRNADepositorAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
-
pCfb13196
Plasmid#219871PurposeThe base plasmid of TUNEYALI forTF06DepositorInsertContains gRNA targeting TF06 (YALI1_D34785g) and homologous arm matching TF06
ExpressionYeastAvailable SinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
SGEP-sh-Hs-PHGDH-1957
Plasmid#188674PurposeshRNADepositorAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
SGEP-sh-Hs-PHGDH-1967
Plasmid#188672PurposeshRNADepositorAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSC38
Plasmid#104812PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr3g107390 (MtRdr6). Also expresses Cas9 from AtUBQ10 promoter.DepositorInsertMedtr3g107390
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHTganA-Cpf1
Plasmid#158647PurposeConstitutive transcription of FnCpf1 and ganA crRNADepositorInsertCpf1, ganA crRNA
UseCRISPR and Synthetic Biology; Shuttle vector baciā¦ExpressionBacterialPromoterP43Available SinceOct. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1B
Plasmid#185383PurposeFor mammalian expression of shRNA: GAGCAGAAGAGGATGAATTTA that targets human PPM1BDepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR plasmid
Plasmid#236553PurposeEncodes Cas9 and two guideRNAs, one to cut the genome downstream of HSPA5 (BiP/GRP78) and one to linearize the DONOR plasmid.DepositorInsertCas9
ExpressionMammalianAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSC37
Plasmid#104811PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr3g107390 (MtRdr6). Also expresses Cas9 from Gmubi promoterDepositorInsertMedtr3g107390
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSB700-mouse-TTN-Cerulean
Plasmid#128325PurposeSP-dCas9 compatible gRNA to be used as a positive control for activation experiments (mouse cells)DepositorInsertgRNA against mouse TTN for activation
ExpressionMammalianAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only