We narrowed to 167,150 results for: addgene
-
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo XLF sgRNA
Plasmid#207605PurposesgRNA for the insert of the HaloTag at the endogenous loci of XLFDepositorInsertGTTCTTCCATctgcaaaaaa
TagsNoneExpressionMammalianAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
HaloXRCC4 sgRNA
Plasmid#207606PurposesgRNA for the insert of the HaloTag at the endogenous loci of XRCC4.DepositorInsertTACTGGGTTCAGAAACAAGG
ExpressionMammalianAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
NarP-GFP
Plasmid#220161PurposeTo track the natural NarP promoter's transcriptional dynamicsDepositorInsertNarP promoter only
ExpressionBacterialAvailable SinceMarch 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB_EF1a_Gag∆MA
Plasmid#212654PurposepiggyBac vector to express MLV Gag with truncated MA domainDepositorInsertMLV Gag (UniProt ID: P03332) (gag MoMLV)
UsePiggybacExpressionMammalianMutationDeletion of MA domain (amino acids 2-215)PromoterEF1aAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZB604_pT7-sfGFP
Plasmid#228510PurposeBacterial Hybrid Reporter Plasmid (sfGFP), pT7-sfGFPDepositorInsertsfGFP
UseSynthetic BiologyPromoterT7Available SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZB641_pT7_Lysin-KU1
Plasmid#228511PurposeT7 RNAP inducible Lysin KU1 ExpressionDepositorInsertLysin KU1
UseSynthetic BiologyPromoterT7Available SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGFP-AUG-IRES-mCherry
Plasmid#222109PurposeStart codon reporter (WT AUG)DepositorInsertGFP-IRES-mCherry
UseLentiviralAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaAll
Plasmid#216878PurposeDerived from the plasmid for Mega GVs, pST39-pNL29 (Addgene #91696), but all gas vesicle proteins have been deleted.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
p8390 LentiCRISPRv2 Neo sgNT-2
Plasmid#221650PurposeExpression of non-targeting control sgRNADepositorInsertnon-targeting sgNT-2
UseCRISPR and LentiviralAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only