We narrowed to 5,242 results for: U6
-
Plasmid#248039PurposeCtrl AAV for in vivo by adeno-associated viral vector-mediated deliveryDepositorInsertControl
UseAAV, CRISPR, and Mouse TargetingTagsnls-TagBFP2ExpressionMammalianPromoterU6Available SinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
LentiGuideFUT3-neo
Plasmid#250304PurposeEncodes gRNA targeting FUT3DepositorAvailable SinceMarch 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPL_sgRNA_3
Plasmid#242892PurposePiggyBac cargo vector with HNRNPL sgRNA 3 for dox-inducible knockdownDepositorAvailable SinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX458_GAPDH-sgRNA
Plasmid#249575PurposeExpresses SpCas9, GFP, and sgRNA targeting GAPDH.DepositorInsertGAPDH-sgRNA
UseCRISPRPromoterU6 promoterAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 mTagBFP2 rat PYGB shRNA
Plasmid#242946PurposeExpresses mTagBFP2 along with an shRNA against rat Glycogen Phosphorylase-BDepositorAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs-RMRP (pAVA3583)
Plasmid#239260PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RMRPDepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RMRP
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs-RMRP (pAVA3584)
Plasmid#239261PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RMRPDepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RMRP
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs-RPPH1 (pAVA3585)
Plasmid#239262PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RPPH1DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RPPH1
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only