We narrowed to 32,111 results for: eng
-
Plasmid#187935PurposeExpress phage alpha3 lysis protein E in bacteriaDepositorInsertPhage alpha 3 lysis protein E
TagsStrep IIExpressionBacterialPromoterT7 promoterAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT02
Plasmid#223374PurposeT-DNA vector for SpCas9 mediated mutagenesis for plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by AtU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-SpCas9-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT04
Plasmid#223376PurposeT-DNA vector for SpCas9 mediated mutagenesis for monocot plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-SpCas9-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmirGLO-mir1-8mer4x (pEZ184)
Plasmid#229058PurposeDual-luciferase reporter containing 4 copies of the 8mer site of human miR-1DepositorInsertHuman miR-1 binding sites
ExpressionMammalianAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET29_anti-MERS-Nanobody-VHH-1
Plasmid#206890PurposeExpress anti-MERS-Nanobody-VHH-1 in E. coliDepositorInsertanti-mers-nanobody-vhh-1
Tags6xHisExpressionBacterialAvailable SinceJan. 13, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET29_anti-MERS-Nanobody-VHH-55
Plasmid#209417PurposeExpress anti-MERS-Nanobody-VHH-55 in E. coliDepositorInsertanti-mers-nanobody-vhh-55
Tags6xHisExpressionBacterialAvailable SinceJan. 13, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET29_anti-MERS-Nanobody-VHH-83
Plasmid#209418Purposeexpress anti-MERS-Nanobody-VHH-83 in E. coliDepositorInsertanti-mers-nanobody-vhh-83
Tags6xHisExpressionBacterialAvailable SinceJan. 13, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET29_anti-MERS-Nanobody-VHH-84
Plasmid#209419PurposeExpress anti-MERS-Nanobody-VHH-84 in E. coliDepositorInsertanti-mers-nanobody-vhh-83
Tags6xHisExpressionBacterialAvailable SinceJan. 13, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pOSV00157
Plasmid#222937PurposeKill switch plasmid for DNA sensor construction using Bacillus subtilisDepositorInsertTxpA-RatA toxin-antitoxin
ExpressionBacterialPromoterPhyperspankAvailable SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP H2B SL2
Plasmid#227718PurposePlasmid contains GFP H2B SL2, with some nlp-51 homology sequence after, Amp ResistantDepositorInsertGFP H2B SL2 (nlp-51 Nematode)
UseCloning vectorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-L1374
Plasmid#226275PurposePlasmid expressing the SEC18 allele from L-1374, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-S288C
Plasmid#226274PurposePlasmid expressing the SEC18 allele from S288C, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-NCYC110
Plasmid#226277PurposePlasmid expressing the SEC18 allele from NCYC110, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-UWOPS872421
Plasmid#226276PurposePlasmid expressing the SEC18 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-S288C
Plasmid#226266PurposePlasmid expressing the SCT1 allele from S288C, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-L1374
Plasmid#226267PurposePlasmid expressing the SCT1 allele from L-1374, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-NCYC110
Plasmid#226269PurposePlasmid expressing the SCT1 allele from NCYC110, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-UWOPS872421
Plasmid#226268PurposePlasmid expressing the SCT1 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only