We narrowed to 14,982 results for: egf
-
Plasmid#40834PurposemiRNA sensor used in Drosophila cell linesDepositorInsertFour target sites perfectly complementary to let-7
UseMirna reporterTagsEGFPExpressionInsectPromoterActin5CAvailable sinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-rat PKA-RIIbeta-mEGFP
Plasmid#45530DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPKA regulatory subunit RII beta tagged by mEGFP
UseWith chicken beta actin promoter and wpreExpressionMammalianAvailable sinceJune 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pIRES2-eGFP-Ofd1-Myc-S75F
Plasmid#24580DepositorInsertOfd1 (Ofd1 Mouse)
TagsMyc and eGFPExpressionMammalianMutationserine 75 changed to phenylalanine (codon TCT cha…Available sinceJune 7, 2010AvailabilityAcademic Institutions and Nonprofits only -
CIRC-V1-Ana-CVB3 IRES-EGFP-BsaI
Plasmid#246755PurposeRNA circularization with CIRC using Ana intron, harbouring an CVB3 IRES-EGFP reporter.Plasmid was linearized with BsaI.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCIRC-V1-Ana-CVB3 IRES-EGFP-BsaI
UseSynthetic BiologyAvailable sinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE8e-eVRQR-P2A-EGFP (HES1425)
Plasmid#242657PurposeCMV promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with neVRQR(D10A) and P2A-EGFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertpCMV-ABE8e-SpCas9-VRQR(S55R)-P2A-EGFP
UseCRISPRTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA, eVRQR mutations in SpCas…PromoterCMV and T7Available sinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
VEE-mScarlet3-IRES-EGFP-IRES-moxBFP
Plasmid#242407PurposeNative (conventional) self-amplifying RNA (saRNA) control construct expresses moxBFP as visual marker of IRES functionalityDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsmScarlet3
IRES-EGFP
IRES-moxBFP
UseSelf-amplifying rnaExpressionMammalianAvailable sinceSept. 4, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDisplay-GRAB-HaloDA1.0-IRES-EGFP-CAAX
Plasmid#234410PurposeExpresses the chemigenetic dopamine (DA) sensor GRAB_HaloDA1.0 and a membrane-localized EGFP in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGPCR activation based chemigenetic dopamine (DA) sensor GRAB_HaloDA1.0
ExpressionMammalianPromoterCMVAvailable sinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-EGFP-P2A-iCre (JDW 921)
Plasmid#224519PurposeA Gateway compatible middle entry clone containing EGFP P2A iCre (codon optimized cre)DepositorInsertEGFP-P2A-iCre
UseCre/LoxAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ConVERGD-ConFonvCon-eGFP-W3SL
Plasmid#218752PurposeProvides AND intersectional (Cre+Flp+vCre) expression of eGFPDepositorInserteGFP
UseAAVPromoterhSynAvailable sinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ConVERGD-ConFoff-eGFP-W3SL
Plasmid#218751PurposeProvides NOT intersectional (Cre NOT Flp) expression of eGFPDepositorInserteGFP
UseAAVPromoterhSynAvailable sinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-SNAPf-mEGFPe-IFNAR1(28-557)
Plasmid#187844PurposeExpression of SNAPf and mEGFPe-tagged IFNAR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertIFNAR1 (IFNAR1 Human)
TagsIg k-chain leader sequence, SNAPf-tag, and meGFPe…ExpressionMammalianMutationmeGFPe: asparagine 198 to aspartic acid and tyros…PromoterCMVAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable sinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-EGFP barcode-3-SV40 polyA
Plasmid#190867PurposeFor barcoded retrograde labelingDepositorInsertEGFP-barcode3
UseAAVMutationWTAvailable sinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-EGFP barcode-4-SV40 polyA
Plasmid#190868PurposeFor barcoded retrograde labelingDepositorInsertEGFP-barcode4
UseAAVMutationWTAvailable sinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
AiP5001 RabV-CVS-N2cdeltaG-histone-EGFP
Plasmid#176283PurposeRecombinant rabies virus expressing histone-EGFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianAvailable sinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
EK0301 SFFV-mCherry-SG(Bdnf.s1)SG-EGFP (FLP-IN)
Plasmid#191144PurposeExpression of Sensor for murine Bdnf 3' UTR in mammalian cells; mCherry marker, EGFP output; 90 bp longDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmCherry:Bdnf.s1:EGFP
ExpressionMammalianMutationWTPromoterSFFVAvailable sinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-APEX.NES-P2A-EGFP
Plasmid#182824PurposeCre-dependent expression of cytosolic APEXDepositorInsertAPEX.NES-P2A-EGFP
UseAAVTagsEGFP reporter (P2A)PromoterEF1aAvailable sinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCI-T7Max-UTR1-deGFP-8xHis-T500
Plasmid#178422PurposeExpression of deGFP via a T7 Promoter in TXTLDepositorInsertdeGFP
UseSynthetic BiologyTags8xHis TagExpressionBacterialPromoterT7MaxAvailable sinceDec. 15, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA5/FRT/TO_H2B-HaloTag10-T2A-EGFP
Plasmid#175521PurposeNuclear expression of HaloTag10 in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertH2B-HaloTag10
ExpressionMammalianMutationHaloTag10 = HaloTag7-Q165WAvailable sinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
PB-mCar-EGFP-WPRE-BGH-pA-UBC-Bla
Plasmid#174620PurposePiggyBac plasmid expressing EGFP under the control of a cone arrestin promoterDepositorInsertenhanced green fluorescent protein
UsePiggybacExpressionMammalianAvailable sinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only