We narrowed to 8,732 results for: sgRNA
-
Plasmid#77822Purpose3rd generation lentiviral gRNA plasmid targeting human MAP2K7DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
MAP2K7 gRNA (BRDN0001162371)
Plasmid#77823Purpose3rd generation lentiviral gRNA plasmid targeting human MAP2K7DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
HUNK gRNA (BRDN0001148239)
Plasmid#75940Purpose3rd generation lentiviral gRNA plasmid targeting human HUNKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
IKBKB gRNA (BRDN0001148638)
Plasmid#76091Purpose3rd generation lentiviral gRNA plasmid targeting human IKBKBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDC7 gRNA (BRDN0001149415)
Plasmid#76682Purpose3rd generation lentiviral gRNA plasmid targeting human CDC7DepositorAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEN243-EN1953
Plasmid#224546PurposeCas9-2A-puro and sgRNA targeting the first coding ATG of mouse NipblDepositorInsertCas9-2A-puro and sgRNA targeting the first coding ATG of mouse Nipbl (Nipbl Mouse)
ExpressionMammalianAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEN243-KH217
Plasmid#224550PurposeCas9-2A-puro and sgRNA targeting the STOP codon mouse Car2DepositorInsertCas9 and sgRNA targeting the STOP codon of mouse CAR2 (Car2 Mouse)
UseCRISPRExpressionMammalianAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-CNCB_sgEIF3D-1
Plasmid#236765PurposeA piggybac-based vector containing mouse U6 promoter-driven EIF3D sgRNA #1 and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorInsertEIF3D sgRNA-1 (EIF3D Human)
UsePiggybacExpressionMammalianPromotermouse U6 promoter and mouse U6 promoter, CAG prom…Available SinceJuly 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMCB320 sgControl (ACOCB)
Plasmid#228115PurposeSafe targeting sgRNADepositorInsertSafe targeting sgRNA
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMCB320 sgControl (GEA)
Plasmid#228144PurposeSafe targeting sgRNADepositorInsertSafe targeting sgRNA
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH020 sgControl (GEA)
Plasmid#228193PurposeSafe targeting sgRNADepositorInsertSafe targeting sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhuman U6Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH020 sgControl (ACOCB)
Plasmid#228194PurposeSafe targeting sgRNADepositorInsertSafe targeting sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhuman U6Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3-NCL-gRNA1-EGFP
Plasmid#226004PurposeCRISPRi-KD of human NucleolinDepositorInsertsgRNA targeting human Nucleolin (NCL Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-NCL-gRNA2-EGFP
Plasmid#226005PurposeCRISPRi-KD of human NucleolinDepositorInsertsgRNA targeting human Nucleolin (NCL Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_DAZL_cterm2
Plasmid#222919PurposeCas9/sgRNA plasmid for targeting DAZLDepositorInsertCas9, DAZL sgRNA 2 (DAZL Synthetic, Human)
UseCRISPRAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_DAZL_cterm3
Plasmid#222920PurposeCas9/sgRNA plasmid for targeting DAZLDepositorInsertCas9, DAZL sgRNA 3 (DAZL Synthetic, Human)
UseCRISPRAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_TFAP2C_cterm
Plasmid#222916PurposeCas9/sgRNA plasmid for targeting TFAP2CDepositorInsertCas9, TFAP2C sgRNA (TFAP2C Synthetic, Human)
UseCRISPRAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_FIGLA_cterm4
Plasmid#222909PurposeCas9/sgRNA plasmid for targeting FIGLADepositorInsertCas9, FIGLA sgRNA 4 (FIGLA Synthetic, Human)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_FIGLA_cterm3
Plasmid#222908PurposeCas9/sgRNA plasmid for targeting FIGLADepositorInsertCas9, FIGLA sgRNA 3 (FIGLA Synthetic, Human)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only