We narrowed to 7,224 results for: /1000
-
Plasmid#144417PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only
-
GFP-Bcl2-Cb5
Plasmid#18000DepositorInsertER targeted Bcl-2 (BCL2 Human)
TagsGFPExpressionMammalianMutationBcl-2's C terminal targeting sequence replac…PromoterCMVAvailable SinceJune 4, 2008AvailabilityAcademic Institutions and Nonprofits only -
pET28a-DDX43
Plasmid#134574PurposeExpress human DDX43 protein (WT, full-length) in E. coliDepositorAvailable SinceJan. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
sg_Trp53_i4-ipUSEPR-TR657
Plasmid#228930PurposeKnockdown of Trp53 in mammalian cellsDepositorInsertsg_Trp53_i4 (Trp53 Mouse, sequence: GTCGCTACCTACAGCCAGGA)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-ALDOA_sgRNA1
Plasmid#201590PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertALDOA (ALDOA Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
ACTB-(A)4x
Plasmid#112058PurposeACTB mRNA tagged with 4 copies of Riboglow (variant A)DepositorInsertACTB (ACTB Human)
TagsRiboglow RNA tagExpressionMammalianMutation4 copies of Riboglow tag after stop codonPromoterCMVAvailable SinceJuly 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-Bcl2-Maob
Plasmid#18001DepositorInsertMitochondria-targeted Bcl-2 (BCL2 Human)
TagsGFPExpressionMammalianMutationBcl-2's C terminal replaced with mitochondri…PromoterCMVAvailable SinceJune 4, 2008AvailabilityAcademic Institutions and Nonprofits only -
acta2_mCherry_pA_pDestTolpA2
Plasmid#78685Purposeacta2:mCherry transgenesis constructDepositorAvailable SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cav2.1 HA pcDNA3
Plasmid#206069Purposeexpression of rat Cav2.1 calcium channel with a E1686R mutation to enhance expression and an exofacial double HA tag in domain IIDepositorAvailable SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
DYR1A_HUMAN_D0
Plasmid#79690PurposeThis plasmid encodes the kinase domain of DYR1A. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
TFORF0608
Plasmid#142659PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceMay 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGLS3-5xHRE-p53(K120R)
Plasmid#72554PurposeHypoxia induced mutant p53. Contains the HRE from VEGF sequence (5 repeats) upstream of p53 K120R.DepositorInsertp53 (TP53 Human)
Tags5XHREExpressionMammalianMutationK120RPromoterE1B minimal promoterAvailable SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+_FH-AGO2-5xA
Plasmid#92007PurposeExpresses FLAG-HA-AGO2 [S824A, S828A, T830A, S831A, S834A (5xA)]DepositorInsertAGO2 (AGO2 Human)
TagsFLAG-HAExpressionMammalianMutationS824A, S828A, T830A, S831A, S834A (5xA)Available SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
acta2_GFP_pA_pDestTolpA2
Plasmid#78684Purposeacta2:GFP transgenesis constructDepositorAvailable SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTRE-TAZ-CAMTA1
Plasmid#235680PurposeExpress TAZ-CAMTA1 fusion gene in mammalian cells using the doxycycline-inducible TRE promoterDepositorAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+_FH-AGO2-5xE
Plasmid#92008PurposeExpresses FLAG-HA-AGO2 [S824E, S828E, T830E, S831E, S834E (5xE)]DepositorInsertAGO2 (AGO2 Human)
TagsFLAG-HAExpressionMammalianMutationS824E, S828E, T830E, S831E, S834E (5xE)Available SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBKWH-p53
Plasmid#133900PurposePositive control when used in combination with pAWH-largeT. Expression of Gal4BD-p53 hybrid protein. Homology regions for recombination with pAWHDepositorAvailable SinceJune 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
EDNRB-DuET
Plasmid#213233PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 _3xHA-Ago2
Plasmid#73538PurposeInducible lentiviral expression of Ago2DepositorInsertAgo2 (Ago2 Mouse)
UseLentiviralTags3xHAExpressionMammalianPromoterTRE promoter, Tet ONAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
JAM2_pcDNA6.2/EmGFP-Bsd
Plasmid#176966PurposeMammalian expression vector encoding JAM2 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only