-
Plasmid#138988PurposeIVT template for the beta subunit of the mouse TCR #32 that is reactive against MC38DepositorInsertTCRB (Tcrb Mouse)
UseTagsExpressionMammalianMutationPromoterCMV and T7Available sinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRA-32-riot_punisher
Plasmid#138987PurposeIVT template for the alpha subunit of the mouse TCR #32 that is reactive against MC38DepositorInsertTCRA (Tcra Mouse)
UseTagsExpressionMammalianMutationPromoterCMV and T7Available sinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRB-31-murderous_crow
Plasmid#138986PurposeIVT template for the beta subunit of the mouse TCR #31 that is reactive against MC38DepositorInsertTCRB (Tcrb Mouse)
UseTagsExpressionMammalianMutationPromoterCMV and T7Available sinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRA-31-murderous_crow
Plasmid#138985PurposeIVT template for the alpha subunit of the mouse TCR #31 that is reactive against MC38DepositorInsertTCRA (Tcra Mouse)
UseTagsExpressionMammalianMutationPromoterCMV and T7Available sinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRB-30-picky_sticky
Plasmid#138984PurposeIVT template for the beta subunit of the mouse TCR #30 that is reactive against MC38DepositorInsertTCRB (Tcrb Mouse)
UseTagsExpressionMammalianMutationPromoterCMV and T7Available sinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBCMV-MS2CP-eDHFR
Plasmid#167309PurposeTemplate pDNA to prepare a split CaVT component mRNADepositorInsertMS2CP-eDHFR
UseSynthetic BiologyTagsDYK-tagExpressionMammalianMutationPromoterCMVAvailable sinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBS-f1(-)-ACTB-iTagRFP-T
Plasmid#115916Purposedonor to insert iTagRFP-T at the ACTB locus in human cellsDepositorInsertACTB-TagRFP-T
UseDonor templateTagsTagRFP-TExpressionMutationPromoterAvailable sinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBS-f1(-)-SEC61B-dTomato
Plasmid#115920Purposedonor to insert dTomato at the SEC61B locus in human cellsDepositorInsertSEC61B-dTomato
UseDonor templateTagsdTomatoExpressionMutationPromoterAvailable sinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHDR-CDKN2A-Ex2-CMV-H2B-mOrange2
Plasmid#110735PurposeRecombination template for replacing CDKN2A Exon2 with Ef1alpha-H2B-mOrange2DepositorInsertH2B-mOrange2
UseOtherTagsExpressionMutationPromoterAvailable sinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHyg-AID(1-114)
Plasmid#99513PurposeTruncated C-terminal AID degron cassette with HygR marker for S. cerevisiaeDepositorInsertIAA17(1-114) (AXR3 Mustard Weed)
UsePcr template for yeast tagging cassetteTagsExpressionMutationinternal inversion of nucleotides 265-312 of the …PromoterAvailable sinceSept. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
XZ390 (IVT) CMV-TO-T7-mCherry-SGc(stem-1(3xMS2))cSG-rTetR-NZF-NLS-hybridUTR3
Plasmid#233425PurposeIVT template for LIDAR reporter mRNA; mCherry as marker, rtetR-NZF as outputDepositorInsertT7-mCherry-SGc(stem-1(3xMS2))cSG-rTetR-NZF-NLS-hybridUTR3
UseTagsExpressionMammalianMutationWTPromoterCMVAvailable sinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT7-IVT_ACC-msfGFP[r5M]_ACC-mEBFP2
Plasmid#221082PurposePlasmid for producing DNA Templates for in vitro transcription. Produces msfGFP[r5M] and mEBFP2 from IVT mRNA.DepositorInsertACC-msfGFP[r5M]_ACC-mEBFP2
UseSynthetic BiologyTagsExpressionMutationPromoterCMV, T7Available sinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHDR_NPM2-T2A-mGreenLantern-PuroTK
Plasmid#222910PurposeHomology directed repair template for knocking in mGreenLantern reporter to NPM2.DepositorInsertmGreenLantern
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHDR_FIGLA-T2A-mGreenLantern-PuroTK
Plasmid#222905PurposeHomology directed repair template for knocking in mGreenLantern reporter to FIGLA.DepositorInsertmGreenLantern
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHDR2_TFAP2C-T2A-mGreenLantern-Hygro
Plasmid#222915PurposeHomology directed repair template for knocking in mGreenLantern reporter to TFAP2C.DepositorInsertmGreenLantern
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
PTAFR-DuET
Plasmid#213368PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertPTAFR (PTAFR Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-RPLP15UTR-hRluc-A60
Plasmid#182639PurposeTranscription template plasmid for RPLP1 5'UTR followed by Renilla luciferase open reading frame and polyA sequenceDepositorInsertRenilla luciferase
UseLuciferaseTagsExpressionMammalianMutationThe transcription is driven by a T7 promoter, pai…PromoterAvailable sinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD71Cas10.6RT4-Pct5.1-crRNA(hcdR)-RT(ΔhcdR)
Plasmid#191646PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), cumate-inducible promoter Pct5.1-crRNA(hcdR-targeting spacer) hcdR-deleting repair template, used for hcdR deletionDepositorInsertCymR
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only