We narrowed to 16,006 results for: grna
-
Plasmid#90682Purpose3rd generation lentiviral gRNA plasmid targeting human ESPL1DepositorInsertESPL1 (Guide Designation D7.1)
UseCRISPR and LentiviralPromoterU6Available sinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
GINS1 D11.1 gRNA
Plasmid#90694Purpose3rd generation lentiviral gRNA plasmid targeting human GINS1DepositorInsertGINS1 (Guide Designation D11.1)
UseCRISPR and LentiviralPromoterU6Available sinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBBK19 pCAS-Tyr-[gRNA: 2=FF21] (SplitHygR, AmpR)
Plasmid#179003PurposeSp.Cas9 and gRNA yeast expression vector with FF21 gRNA pre-cloned. Selection =SplitHygromycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK12 pCAS-Tyr-[gRNA: 2=FF21] (SplitKanR, AmpR)
Plasmid#178996PurposeSp.Cas9 and gRNA yeast expression vector with FF21 gRNA pre-cloned. Selection =SplitKanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK11 pCAS-Tyr-[gRNA: 1=FF18] (SplitKanR, AmpR)
Plasmid#178995PurposeSp.Cas9 and gRNA yeast expression vector with FF18 gRNA pre-cloned. Selection =SplitKanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-Chrna2-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128337PurposepAAV encoding gRNA sequence for loss-of-function indelsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertChrna2 (Chrna2 Mouse)
UseCRISPRExpressionMammalianAvailable sinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-Chrna4-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128339PurposepAAV encoding gRNA sequence for loss-of-function indelsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertChrna4 (Chrna4 Mouse)
UseCRISPRExpressionMammalianAvailable sinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-Chrna7-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128342PurposepAAV encoding gRNA sequence for loss-of-function indelsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertChrna7 (Chrna7 Mouse)
UseCRISPRExpressionMammalianAvailable sinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
p206_LTJ_sgRNACD45.2_R3
Plasmid#82674PurposesgRNA targeting murine CD45.2 region 3. Co-expresses SpCas9-2A-EGFP.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting CD45.2 region 3
UseCRISPRExpressionMammalianPromoterU6Available sinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKSB-609 U6-sgRNA1 ATCC GGAA
Plasmid#173671PurposeTo clone and express a gRNA in AnophelesDepositorTypeEmpty backboneUseCRISPRExpressionInsectAvailable sinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBBK03 pCAS-Tyr-[gRNA: BsaI GFP dropout] (HygR,AmpR)
Plasmid#178987PurposeSp.Cas9 and gRNA yeast expression vector for HDR-based gRNA introduction. Selection = Hygromycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK01 pCAS-Tyr-[gRNA: BsaI GFP dropout] (KanR, AmpR)
Plasmid#178985PurposeSp.Cas9 and gRNA yeast expression vector for HDR-based gRNA introduction. Selection = Kanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458-sgRNA_Ago2_3
Plasmid#73531PurposeExpresses SpCas9, GFP, and sgRNA targeting Ago2DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAGO2
UseCRISPRExpressionMammalianPromoterhU6Available sinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX458-sgRNA_Ago2_4
Plasmid#73532PurposeExpresses SpCas9, GFP, and sgRNA targeting Ago2DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAGO2
UseCRISPRExpressionMammalianPromoterhU6Available sinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Dicer_3
Plasmid#68809Purposespecific sgRNA against mouse Dicer1 gene cloned in the pX330 backbone (Addgene Number 42230). Generation of Dicer1 knockout mESCs.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA mouse Dicer1
UseCRISPR and Mouse TargetingExpressionBacterial and MammalianAvailable sinceFeb. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB3043(gRNA XI-1)
Plasmid#73285PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XI-1DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(ARID1A(44))-hU6gRNA5(AAVS1)-PGKpuroBFP-W
Plasmid#200506PurposeLentiviral vector expressing gRNA targeting human ARID1A and AAVS1DepositorAvailable sinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(AAVS1)-hU6gRNA5(BbsI)-PGKpuroBFP-W
Plasmid#200502PurposeLentiviral vector expressing gRNA targeting human AAVS1DepositorInsertAAVS1 (AAVS1 Human)
UseLentiviralAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(SMARCA4(43))-hU6gRNA5(AAVS1)-PGKpuroBFP-W
Plasmid#200503PurposeLentiviral vector expressing gRNA targeting human SMARCA4 and AAVS1DepositorAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only