We narrowed to 14,065 results for: CAN
-
Plasmid#107163PurposeExpresses specific cyclic-ADP-ribose (cADPR) phosphohydrolase in Escherichia coli as a GST fusion protein that can be cut with PreScission(TM) protease to yield active enzymeDepositorInsertF37A+L196F+V252A+C253G-hADPRM GST-mutant cADPR phosphohydrolase gene
TagsGSTExpressionBacterialPromotertacAvailable SinceMarch 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-19b-1-5p
Plasmid#103325PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-19b-1-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-19b-1-5p target (MIR19B1 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
HA-BAP1-N102S-GFP
Plasmid#78915PurposeMammalian expression of BAP1 with N102S and an EGFP fusionDepositorAvailable SinceJuly 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-522-3p
Plasmid#103614PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-522-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-522-3p target (MIR522 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-183-5p
Plasmid#103285PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-183-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-183-5p target (MIR183 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a_crRNA NC
Plasmid#176256PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged with Nlux and spacer sequence is replaced by the type IIS restriction site for endonuclease BaeI that can beDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationD917A and E1006A mutations to inactivate the endo…Available SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-483-5p
Plasmid#103551PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-483-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-483-5p target (MIR483 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-193a-3p
Plasmid#103305PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-193a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-193a-3p target (MIR193A Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-20a-3p
Plasmid#103341PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-20a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-20a-3p target (MIR20A Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only