We narrowed to 9,579 results for: Pol
-
Plasmid#113972PurposeSingle short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP2
Plasmid#113973PurposeSingle short guide RNA targeting GCGCGTTCTTTGGACGCGA in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP3
Plasmid#113974PurposeSingle short guide RNA targeting CGTGATGTTGTACCGCTTC in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFP.R373
Plasmid#138243PurposeExpresses the split mCherry reporter interrupted by the SaP-dpol intein (in cis)DepositorInsertsUseSynthetic BiologyTags6xHisExpressionBacterialPromoterP(araBAD) and iPCAvailable SinceJuly 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBz106_CsoS2_MR
Plasmid#140843PurposeHis-tagged CsoS2 Middle Region (MR), pET-14b backboneDepositorInsertCsoS2 Middle Region (MR)
TagsHexahistidine tagExpressionBacterialMutationonly amino acids 257-603PromoterT7Available SinceJune 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLz75_CB_operon_CsoS2_N3-N4
Plasmid#140857PurposeSame as pLz37 but with CsoS2 truncated such that NTD repeats N1 and N2 are removedDepositorInsertCbbL, CbbS, CsoS2 (delN1-N2), CsoSCA, CsoS4A, CsoS4B, CsoS1C, CsoS1A, CsoS1B, CsoS1D
ExpressionBacterialMutationdeleted amino acids 1-109 of CsoS2Available SinceJune 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLz77_CB_operon_CsoS2_N3
Plasmid#140859PurposeSame as pLz37 but with CsoS2 discontinuously truncated such that repeats N1, N2, and N4 are removedDepositorInsertCbbL, CbbS, CsoS2 (delN1-N2, N4), CsoSCA, CsoS4A, CsoS4B, CsoS1C, CsoS1A, CsoS1B, CsoS1D
ExpressionBacterialMutationdeleted amino acids 1-108 and 220-235 of CsoS2Available SinceJune 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLz78_CB_operon_CsoS2_delNTD
Plasmid#140860PurposeSame as pLz37 but with CsoS2 truncated to remove the entire NTD (i.e. N1, N2, N3, and N4 are removed)DepositorInsertCbbL, CbbS, CsoS2 (delNTD), CsoSCA, CsoS4A, CsoS4B, CsoS1C, CsoS1A, CsoS1B, CsoS1D
ExpressionBacterialMutationdeleted amino acids 1-235 of CsoS2Available SinceJune 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLz76_CB_operon_CsoS2_N4
Plasmid#140858PurposeSame as pLz37 but with CsoS2 truncated such that NTD repeats N1, N2, and N3 are removedDepositorInsertCbbL, CbbS, CsoS2 (delN1-N3), CsoSCA, CsoS4A, CsoS4B, CsoS1C, CsoS1A, CsoS1B, CsoS1D
ExpressionBacterialMutationdeleted amino acids 1-189 of CsoS2Available SinceJune 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBz109_CsoS2_NTD
Plasmid#140842PurposeHis-tagged CsoS2 N-terminal domain (NTD), pET-14b backboneDepositorInsertCsoS2 N-terminal domain (NTD)
TagsHexahistidine tagExpressionBacterialMutationdeleted amino acids 262-869PromoterT7Available SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
sg1
Plasmid#113966PurposeSingle short guide RNA targeting GTATAGCATACATTATACGDepositorInsertsg1
PromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBz110_CsoS2_CTD
Plasmid#140844PurposeHis-tagged CsoS2 C-terminal domain (CTD), pET-14b backboneDepositorInsertCsoS2 C-terminal domain (CTD)
TagsHexahistidine tagExpressionBacterialMutationdeleted amino acids 1-594PromoterT7Available SinceMay 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKM136
Plasmid#134177PurposeBacterial expression of his-CENP-C 700-943DepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR207-OEP7(1–50)
Plasmid#100601PurposeGateway entry vector for AtOEP7(1–50)DepositorInsertOEP7(1–50) (OEP7 Mustard Weed)
UseGateway entry vectorAvailable SinceFeb. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pst39-NST-clone14
Plasmid#133421PurposeS. cerevisiae Nip1 (with C-terminal TEV cleavage site and strep-II tag), Sui1 and Tif5B6 (with N-terminal 7xHis tag and TEV cleavage set) coding sequences with intervening ribosome binding sites and other cis-elements for expression as a polycistron, T7 theta 10 promoter (and corresponding terminator after polycistron).DepositorExpressionBacterialMutationORF for Nip1 encodes aa 4-156 (not complete ORF),…Available SinceJan. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFA-dabAB2
Plasmid#133012PurposepFA carrying the badabA2 (locus_tag: BAS2958) and badabB2 genes (locus_tag: BAS2959)DepositorInsertsdabB2
dabA2
ExpressionBacterialPromotertetRAvailable SinceNov. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFE-dabAB2 C351A
Plasmid#133005PurposepFE carrying a dabA2 gene with a C351A mutation and a dabB2 gene (Uniprot: D0KWS8)DepositorInsertsdabB2
dabA2
ExpressionBacterialMutationC351APromotertetRAvailable SinceNov. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
YCe1885 HC_Kan_Kozak-ATG-MLS_p6
Plasmid#100676Purposepart designed to occupy position 6 of EMMA. Functional category: Signal peptide for subcellular targetingDepositorInsertKozak-ATG-MLS
UseSynthetic BiologyAvailable SinceNov. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
YCe2735 HC_Kan_Kozak-ATG-IgkL_p6
Plasmid#100697Purposepart designed to occupy position 6 of EMMA. Functional category: Signal peptide for subcellular targetingDepositorInsertKozak_ATG_IgkL
UseSynthetic BiologyAvailable SinceNov. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
CTL2 (M2225R)
Plasmid#96952PurposeExpresses C-Terminal segment of C. elegans Piezo1 with M2225R mutation in E. coliDepositorInsertCTL2 (M222R) of PIEZO1
Tags6x Histidine TagExpressionBacterialPromoterT7 PromoterAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only