We narrowed to 5,470 results for: crispr cas9 grna plasmid
-
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV hUbC-Cas9-P2A-Puro_BsmBI-sgRNA-BsmBI
Plasmid#188703PurposeLentivirus transfer plasmid encoding Cas9, puromycin resistance, and a BsmBI array for cloning 4 sgRNAsDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-SA-WTmLdlrEx14-gRNA2-N22-HLP-SACas9-HA-OLLAS-spA
Plasmid#206860PurposeAn AAV plasmid with U6 promoter driving a gRNA against LDLR and liver specific HLP promoter driving SaCas9DepositorInsertmLdlr gRNA (Ldlr Mouse)
UseAAV and CRISPRAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-P3-evoCjCas9-TadCDd_gRNA
Plasmid#202563PurposeP3-evoCjCas9-TadCDd and hU6-BsmBI-gRNA in AAV2 backbone (ITRs)DepositorInsertevoCjCas9-TadCDd
UseAAVAvailable SinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-P3-evoCjCas9-eAID_gRNA
Plasmid#202562PurposeP3-evoCjCas9-eAID and hU6-BsmBI-gRNA in AAV2 backbone (ITRs)DepositorInsertevoCjCas9-eAID
UseAAVAvailable SinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-HiFi SpCas9 (without sgRNA; with silent mutations)
Plasmid#126778PurposeExpression plasmid for human codon-optimized increased fidelity HiFi SpCas9 (without U6-sgRNA coding sequence, with silent mutations)DepositorInsertHiFi SpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationR691APromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-Sniper SpCas9 (without sgRNA; with silent mutations)
Plasmid#126777PurposeExpression plasmid for human codon-optimized increased fidelity Sniper SpCas9 (without U6-sgRNA coding sequence, with silent mutations)DepositorInsertSniper SpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationF539S, M763I, K890NPromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-SpCas9-HF1 (without sgRNA; with silent mutations)
Plasmid#126755PurposeExpression plasmid for human codon-optimized increased fidelity SpCas9-HF1 (without U6-sgRNA coding sequence, with silent mutations)DepositorInsertSpCas9-HF1
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926APromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-SpCas9-miniU6-sgRNAShank3
Plasmid#213973PurposeAAV vector to express SpCas9 driven by pCALM1 promoter for targeting Shank3 locusDepositorInsertShank3 sgRNA
UseAAV and CRISPRAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only