We narrowed to 5,271 results for: crispr cas9 expression plasmids
-
Plasmid#236781PurposeExpression of Cas9 cytosine base editor (CBE), T7 RNAP, Cas12a and hygromycin selection marker. The CBE contains a ssDNA-DBD from the H. sapiens RAD51 protein. This plasmid is transfected as episome.DepositorInserthyBE4max (CBE); Cas12a (Acidaminococcus sp. BV3L6)-P2A-T7 RNAP
UseCRISPRAvailable SinceApril 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDonor RUNX3-P2A-tdTomato
Plasmid#246655PurposeDonor plasmid for Crispr/Cas9 gene editing of the human RUNX3 locusDepositorInsertP2A-tdTomato flanked by RUNX3 homology regions (RUNX3 Synthetic, Human)
UseCRISPRExpressionMammalianAvailable SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDonor MAFA-P2A-tdTomato
Plasmid#246654PurposeDonor plasmid for Crispr/Cas9 gene editing of the human MAFA locusDepositorInsertP2A-tdTomato flanked by MAFA homology regions (MAFA Synthetic, Human)
UseCRISPRExpressionMammalianAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
px-458-sgRNA-IF1
Plasmid#206923PurposePlasmid expressing Cas9, GFP and guides to human IF1 to generate IF1-KO mammalian cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDonor AVIL-P2A-iCre
Plasmid#246652PurposeDonor plasmid for Crispr/Cas9 gene editing of the human AVIL locusDepositorInsertP2A-iCre flanked by AVIL homology regions (AVIL Synthetic, Human)
UseCRISPRExpressionMammalianAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDonor NTRK1-P2A-tdTomato
Plasmid#246653PurposeDonor plasmid for Crispr/Cas9 gene editing of the human NTRK1 locusDepositorInsertP2A-tdTomato flanked by NTRK1 homology regions (NTRK1 Synthetic, Human)
UseCRISPRExpressionMammalianMutationtdTomato was altered to contain a silent SAL1 res…Available SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTB106-Hyg
Plasmid#236779PurposeExpression of Cas9 cytosine base editor (CBE), T7 RNAP, Cas12a and hygromycin selection marker. The CBE contains a ssDNA-DBD from the L. major RAD51 protein. This plasmid is transfected as episome.DepositorInserthyBE4max (CBE); Cas12a (Acidaminococcus sp. BV3L6)-P2A-T7 RNAP
UseCRISPRAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTB107-Phleo
Plasmid#236782PurposeExpression of Cas9 cytosine base editor (CBE), T7 RNAP, Cas12a and phleomycin selection marker. The CBE contains a ssDNA-DBD from the H. sapiens RAD51 protein. This plasmid is transfected as episome.DepositorInserthyBE4max (CBE); Cas12a (Acidaminococcus sp. BV3L6)-P2A-T7 RNAP
UseCRISPRAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTP MYRF sg1
Plasmid#88857PurposepAC154-dual-dCas9VP160-sgExpression with MYRF sg1 cloned into BbsI siteDepositorAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTP MYRF sg2
Plasmid#88858PurposepAC154-dual-dCas9VP160-sgExpression with MYRF sg2 cloned into BbsI siteDepositorAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTP MYRF sg3
Plasmid#88859PurposepAC154-dual-dCas9VP160-sgExpression with MYRF sg3 cloned into BbsI siteDepositorAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTP MYRF sg4
Plasmid#88860PurposepAC154-dual-dCas9VP160-sgExpression with MYRF sg4 cloned into BbsI siteDepositorAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTP MYRF sg5
Plasmid#88861PurposepAC154-dual-dCas9VP160-sgExpression with MYRF sg5 cloned into BbsI siteDepositorAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTP MYRF sg6
Plasmid#88862PurposepAC154-dual-dCas9VP160-sgExpression with MYRF sg6 cloned into BbsI siteDepositorAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMJ1.19 (AAVS1 RNA donor in pCDNA3.1)
Plasmid#238007Purpose300bp donor RNA complementary to Cas9 cut site at AAVS1 (Addgene plasmid #72833) with intronic sequence intervening the 3bp insertion signature (ATC). Can be used to measure RT-DSBR in human cells.DepositorUseRna donor to study rt-dsbrExpressionMammalianMutation3bp insertion signature (ATC) at Cas9 cut site in…PromoterCMVAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28b-Hf-RfxCas13d-His
Plasmid#234480PurposePlasmid for bacterial expression and purification of High-fidelity RfxCas13d protein (human codon-optimized)DepositorInsertRfxCas13d
UseCRISPRTags6xHisExpressionBacterialMutationChanged four alanine to valine in positions 134, …Available SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only