We narrowed to 7,221 results for: mCherry
-
Plasmid#46275DepositorAvailable SinceAug. 27, 2013AvailabilityAcademic Institutions and Nonprofits only
-
pJZC34
Plasmid#62331PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2(wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
delCMV-mCherry-3x-p67phox-GBD
Plasmid#214141PurposeRac activity sensorDepositorInsert3xp67phox-GBD (NCF2 Human)
TagsmCherryExpressionMammalianMutationOnly the GTPase binding domain (GBD) is includedPromoterdelCMVAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
p13xQUAS-ZsGreen-P2A, α-cry:mCherry
Plasmid#180480PurposeInducible gene expression vector p13xQUAS-ZsGreen-P2A, α-cry:mCherryDepositorInsert13x QUAS-ZsGreen-P2A
UseSynthetic BiologyAvailable SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV CMV mCherry-DDX21-V5
Plasmid#175163PurposeLentiviral expression of human DDX21-V5DepositorAvailable SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPD_Psra-6::ChR2(H134R)::mCherry
Plasmid#117419PurposeFor selectively expressing ChR2(H134R) in ASH sensory neurons under the expression of a Psra-6 promoterDepositorInsertchannel rhodopsin-2 with H134R mutation
ExpressionWormMutationH134RPromotersra-6Available SinceNov. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTriEx-mCherry-LOV2 I427V
Plasmid#81044Purposemammalian expression of LOV2 I427VDepositorInsertLOV I427V
TagsmCherryExpressionBacterial, Insect, and Mamm…MutationI427VAvailable SinceAug. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT/TO Plk4 ∆24-mCherry
Plasmid#80271Purposemammalian expression plasmid for Plk4 with multi-phospho degron deletedDepositorInsertPlk4 (PLK4 Human)
TagsmCherryExpressionMammalianMutationdeletion of multi-phospho degron (amino acids 282…PromoterCMVAvailable SinceAug. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-histone H3
Plasmid#179699Purposevisualization of nucleus/chromosomeDepositorAvailable SinceMarch 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tol2-ISceI-ZSP:EGFP;cryaa:mCherry-ISceI-Tol2
Plasmid#194518PurposeZSP promoter for transgenic enhancer assays in zebrafishDepositorInsertEnhanced Green Fluorescent Protein
UseZebrafish expressionAvailable SinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-CNOT7(minusCNOT6interaction)-V5H6.MCh.Puro
Plasmid#209940PurposeIn mammalian cells expresses TP fused to a CNOT7 that does not interact with CNOT6 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with CNOT6) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-CNOT7(minusNOT1interaction)-V5H6.MCh.Puro
Plasmid#209942PurposeIn mammalian cells expresses TP fused to a CNOT7 that does not interact with NOT1 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with NOT1) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-mCherry-GSG-P2A-NUDT5 T45D-WPRE
Plasmid#250388PurposeLentiviral expression of human NUDT5 T45D with N-terminal mCherry seperated by a flexible GSG-linker and P2Aunder CMV promoter, as well as a puromycin resistance cassette under PGK promoter.DepositorInsertNUDT5 (NUDT5 Human)
UseLentiviralTagsmCherry-GSG-P2AExpressionMammalianMutationT45DPromoterCMVAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-mCherry-GSG-P2A-NUDT5 T45A-WPRE
Plasmid#250387PurposeLentiviral expression of human NUDT5 T45A with N-terminal mCherry seperated by a flexible GSG-linker and P2Aunder CMV promoter, as well as a puromycin resistance cassette under PGK promoter.DepositorInsertNUDT5 (NUDT5 Human)
UseLentiviralTagsmCherry-GSG-P2AExpressionMammalianMutationT45APromoterCMVAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
mc2 mCherry
Plasmid#206219PurposeFor expressing cloned exons as circular RNA. Alternatively, for expressing cDNA (if the EcoRI-XhoI restriction fragment is also removed).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianAvailable SinceAug. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_mCherry_non-targeting
Plasmid#140109PurposeCRISPR-Cas9 library validation (negative control)DepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralPromotergRNA1 under U6 and gRNA2 under H1Available SinceApril 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSCALPS_miR-146aSponge_mCherry_GFP
Plasmid#149718PurposeLentiviral vector expressing a miR-146a decoy spongeDepositorInsert14X miR-146a binding sites
UseLentiviralExpressionMammalianMutationG to T mutation in position 75 of the insertAvailable SinceJuly 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
mCherry-SGEF
Plasmid#129620PurposeRhoGEFDepositorInsertSGEF
ExpressionMammalianPromoterCMVAvailable SinceJan. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
mCherry-PLEKHG4
Plasmid#129618PurposeRhoGEFDepositorInsertPLEKHG4
ExpressionMammalianPromoterCMVAvailable SinceJan. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
mCherry-FGD5
Plasmid#129613PurposeRhoGEFDepositorInsertFGD5
ExpressionMammalianPromoterCMVAvailable SinceJan. 7, 2020AvailabilityAcademic Institutions and Nonprofits only