We narrowed to 15,684 results for: genome

#138100

Golden Gate entry vector for 3rd crRNA cloning with AsCas12a crRNA scaffold flanked by HH and HDV ribozymes

Yiping Qi

Zhang et al Nat Commun. 2021 Mar 29;12(1):1944. doi:

March 31, 2021

Academic Institutions and Nonprofits only

#160565

tRNA and scaffold for the assembly of GBoligomers for the position [4_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.

Diego Orzaez

Vazquez-Vilar et al Front Plant Sci. 2021 Jul 1;12:689937. d

March 24, 2021

Academic Institutions and Nonprofits only

#163170

Lentiviral gRNA plasmid targeting human YAP1 gene, co-expression of BFP tag

Sok Ching Cheong

Chai et al Elife. 2020 Sep 29;9. pii: 57761. doi: 1

Feb. 19, 2021

Academic Institutions and Nonprofits only

#163172

Lentiviral gRNA plasmid targeting human YAP1 gene, co-expression of mCherry tag

Sok Ching Cheong

Chai et al Elife. 2020 Sep 29;9. pii: 57761. doi: 1

Feb. 19, 2021

Academic Institutions and Nonprofits only

#160808

Express ISC mutant POLA1

Richard Possemato

Sviderskiy et al Mol Cell. 2020 Oct 28. pii: S1097-2765(2

Oct. 30, 2020

Academic Institutions and Nonprofits only

#156433

Targeting vector to introduce an AID-eGFP cassette at the mouse Cdca5 (SORORIN) locus using BLASTICIDIN selection. Auxin-inducible degron system. Designed to be used with sgRNA GGGATGCCCGTCATTAAGTG

Elphege Nora

Nora et al Nat Commun. 2020 Nov 5;11(1):5612. doi:

Sept. 2, 2020

Academic Institutions and Nonprofits only