We narrowed to 24,135 results for: CRISPR
-
Plasmid#136381PurposeCRISPRa Gateway entry clone for catalytically dead AaCas12b (D570A) fused with TV activation system, followed by T2A and MCP-TV fusion proteinDepositorInsertAaCas12b (D570A)-TV-T2A-MCP-TV
UseCRISPRExpressionPlantMutationD570AAvailable SinceFeb. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
ROCK1 gRNA (BRDN0001147709)
Plasmid#77593Purpose3rd generation lentiviral gRNA plasmid targeting human ROCK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC41
Plasmid#62332PurposesgRNA (no RNA aptamer addition) with PCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
PCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
SIK2 gRNA (BRDN0001148975)
Plasmid#77139Purpose3rd generation lentiviral gRNA plasmid targeting human SIK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKCQ gRNA (BRDN0001144886)
Plasmid#75553Purpose3rd generation lentiviral gRNA plasmid targeting human PRKCQDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKCQ gRNA (BRDN0001145693)
Plasmid#75554Purpose3rd generation lentiviral gRNA plasmid targeting human PRKCQDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
WEE1 gRNA (BRDN0001145570)
Plasmid#77368Purpose3rd generation lentiviral gRNA plasmid targeting human WEE1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PLK1 gRNA (BRDN0001145759)
Plasmid#76457Purpose3rd generation lentiviral gRNA plasmid targeting human PLK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PFKFB3 gRNA (BRDN0001146230)
Plasmid#76462Purpose3rd generation lentiviral gRNA plasmid targeting human PFKFB3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Direct-seq_lentiGuide-Puro-Tail-8A8G
Plasmid#157981PurposeExpresses programmed gRNA scaffold from U6 promoter. Programmed gRNA scaffold for streamlined scRNA-seq in CRISPR screen (Direct-seq). 3rd generation lentiviral backbone.DepositorInsertS. pyogenes sgRNA cassette (Tail-8A8G)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMEL14
Plasmid#107920PurposeLEU2 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
GSK3A gRNA (BRDN0001148594)
Plasmid#76370Purpose3rd generation lentiviral gRNA plasmid targeting human GSK3ADepositorAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
Direct-seq_lentiGuide-Puro-tRNA-Tail-8A8G
Plasmid#157984PurposeExpresses programmed gRNA scaffold from U6 promoter. Programmed gRNA scaffold for streamlined scRNA-seq in CRISPR screen (Direct-seq). 3rd generation lentiviral backbone.DepositorInsertS. pyogenes sgRNA cassette (tRNA-Tail-8A8G)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
Direct-seq_lentiGuide-Puro-tRNA-Tetra Loop-8A8G
Plasmid#157985PurposeExpresses programmed gRNA scaffold from U6 promoter. Programmed gRNA scaffold for streamlined scRNA-seq in CRISPR screen (Direct-seq). 3rd generation lentiviral backbone.DepositorInsertS. pyogenes sgRNA cassette (tRNA-Tetra-8A8G)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pS23.U6<ActB.mus_C-term-KI_gRNA
Plasmid#207408PurposegRNA from a U6 promoter targeting the mouse ActB near the 3' end of the ORF. Used for C-terminal knockin by DSB repair. [Lab plasmid ID: TU260]DepositorInsertActB
UseCRISPR and Mouse TargetingPromoterU6Available SinceNov. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
PLK1 gRNA (BRDN0001144995)
Plasmid#76459Purpose3rd generation lentiviral gRNA plasmid targeting human PLK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ROCK1 gRNA (BRDN0001145904)
Plasmid#77594Purpose3rd generation lentiviral gRNA plasmid targeting human ROCK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NADK2 gRNA (BRDN0001147240)
Plasmid#78092Purpose3rd generation lentiviral gRNA plasmid targeting human NADK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PDGFRB gRNA (BRDN0001147806)
Plasmid#77059Purpose3rd generation lentiviral gRNA plasmid targeting human PDGFRBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
OSR1 gRNA (BRDN0001146927)
Plasmid#76147Purpose3rd generation lentiviral gRNA plasmid targeting human OSR1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only