We narrowed to 22,522 results for: tes
-
Plasmid#227718PurposePlasmid contains GFP H2B SL2, with some nlp-51 homology sequence after, Amp ResistantDepositorInsertGFP H2B SL2 (nlp-51 Nematode)
UseCloning vectorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-RELA-PGK-EGFP
Plasmid#228051PurposeHomologous donor template for RELA knockout expressing EGFPDepositorInsertEGFP
UseCRISPRExpressionMammalianPromoterPGKAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-RELB-PGK-EGFP
Plasmid#228052PurposeHomologous donor template for RELB knockout expressing EGFPDepositorInsertEGFP
UseCRISPRExpressionMammalianPromoterPGKAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-RELC-PGK-EGFP
Plasmid#228053PurposeHomologous donor template for RELC knockout expressing EGFPDepositorInsertEGFP
UseCRISPRExpressionMammalianPromoterPGKAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-RELA-PGK-tdTomato
Plasmid#228054PurposeHomologous donor template for RELA knockout expressing tdTomatoDepositorInserttdTomato
UseCRISPRExpressionMammalianPromoterPGKAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-RELC-PGK-tdTomato
Plasmid#228056PurposeHomologous donor template for RELC knockout expressing tdTomatoDepositorInserttdTomato
UseCRISPRExpressionMammalianPromoterPGKAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap X10
Plasmid#226552PurposeBacterial expression of N-terminally 6His tagged A1-LCD X10DepositorInsertA1-LCD swap X10
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap X9
Plasmid#226551PurposeBacterial expression of N-terminally 6His tagged A1-LCD X9DepositorInsertA1-LCD swap X9
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap X8
Plasmid#226550PurposeBacterial expression of N-terminally 6His tagged A1-LCD X8DepositorInsertA1-LCD swap X8
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap X6
Plasmid#226548PurposeBacterial expression of N-terminally 6His tagged A1-LCD X6DepositorInsertA1-LCD swap X6
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap X2
Plasmid#226544PurposeBacterial expression of N-terminally 6His tagged A1-LCD X2DepositorInsertA1-LCD swap X2
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-L1374
Plasmid#226275PurposePlasmid expressing the SEC18 allele from L-1374, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-S288C
Plasmid#226274PurposePlasmid expressing the SEC18 allele from S288C, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-NCYC110
Plasmid#226277PurposePlasmid expressing the SEC18 allele from NCYC110, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-UWOPS872421
Plasmid#226276PurposePlasmid expressing the SEC18 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-S288C
Plasmid#226266PurposePlasmid expressing the SCT1 allele from S288C, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-L1374
Plasmid#226267PurposePlasmid expressing the SCT1 allele from L-1374, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-NCYC110
Plasmid#226269PurposePlasmid expressing the SCT1 allele from NCYC110, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only