We narrowed to 42,798 results for: gats
-
Plasmid#173148PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj19a (kcnj19a Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj21
Plasmid#173151PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj21 (zgc:162160 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 endAvailable SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj2a
Plasmid#173127PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj2a (kcnj2a Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj2b
Plasmid#173128PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj2b (kcnj2b Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj3b
Plasmid#173130PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj3b (kcnj3b Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj4
Plasmid#173131PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj4 (kcnj4 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj9
Plasmid#173135PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj9 (kcnj9 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHR: pmU6 sgChr3q29 2xMS2 pUbC MCP-mCherry-p2a-Puro
Plasmid#174118PurposeExpression of sgRNA targeting Chr3q29 (chr3: 195478317 - 195506985, hg38)DepositorInsertsgChr3q29 2xMS2 and MCP-mCherry-p2a-Puro
UseLentiviralPromotermU6 and UbCAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
p663-UBC-miniTurbo-V5-CLK3_IDG-K
Plasmid#170579PurposeGateway destination clone of CLK3 (human) tagged with N-terminal miniTurbo-V5 for generating protein-proximity networks using proximity-dependent biotinylation proteomicsDepositorInsertminiTurbo-V5-CLK3 (CLK3 Human)
UseLentiviral; Gateway destinationTagsminiTurbo-V5ExpressionMammalianPromoterUbiquitinAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
p663-UBC-miniTurbo-V5-EEF2K_IDG-K
Plasmid#170592PurposeGateway destination clone of EEF2K (human) tagged with N-terminal miniTurbo-V5 for generating protein-proximity networks using proximity-dependent biotinylation proteomicsDepositorInsertminiTurbo-V5-EEF2K (EEF2K Human)
UseLentiviral; Gateway destinationTagsminiTurbo-V5ExpressionMammalianPromoterUbiquitinAvailable SinceJuly 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
C415-E01: attB4-stuffer-attB1r
Plasmid#162931PurposeGateway attB4-attB1r entry clone containing a non-transcribed/translated region for use in generating negative control vectorsDepositorInsertstuffer fragment for vector controls
UseSynthetic BiologyAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJJF328_sqt-3_3′UTR_sg2
Plasmid#163867PurposesgRNA targeting sqt-3 (3′UTR) in C. elegans. Backbone: pJJR50.DepositorInsertsgRNA targeting the 3'UTR of sqt-3
UseCRISPRExpressionWormPromoterR07E5.16 (U6)Available SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP1
Plasmid#113972PurposeSingle short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
IBMc050
Plasmid#161938PurposeCarries Golden Gate substitution insert for IBM with M86 intein. Plux2 as C-lobe promoterDepositorInsertpSB1A3-BbsI-M86N-cat-Plux2-B32-M86C-SapI
ExpressionBacterialPromoterPlux2Available SinceMarch 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-zeo-2xStrep-ORF68
Plasmid#162659PurposeLentiviral vector for stable expression of N-terminal 2xStrep-tagged ORF68 in mammalian cellsDepositorInsertORF68
UseLentiviralTagsN-terminal 2xStrep-Tag IIExpressionMammalianPromoterCMVAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-zeo-2xStrep-UL52
Plasmid#162663PurposeLentiviral vector for stable expression of N-terminal 2xStrep-tagged UL52 in mammalian cellsDepositorInsertUL52
UseLentiviralTagsN-terminal 2xStrep-Tag IIExpressionMammalianPromoterCMVAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-2xStrep-ORF68 C415A
Plasmid#162633PurposeExpresses N-terminal 2x-Strep-tagged ORF68 C415A in mammalian cellsDepositorInsertORF68
TagsN-terminal 2xStrep-Tag IIExpressionMammalianMutationAmino acid C415 mutated to alaninePromoterCMVAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-2xStrep-ORF68 H452A
Plasmid#162634PurposeExpresses N-terminal 2x-Strep-tagged ORF68 H452A in mammalian cellsDepositorInsertORF68
TagsN-terminal 2xStrep-Tag IIExpressionMammalianMutationAmino acid H452 mutated to alaninePromoterCMVAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-2xStrep-ORF68 C79A
Plasmid#162635PurposeExpresses N-terminal 2x-Strep-tagged ORF68 C79A in mammalian cellsDepositorInsertORF68
TagsN-terminal 2xStrep-Tag IIExpressionMammalianMutationAmino acid C79 mutated to alaninePromoterCMVAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-2xStrep-ORF68 K435A
Plasmid#162636PurposeExpresses N-terminal 2x-Strep-tagged ORF68 K435A in mammalian cellsDepositorInsertORF68
TagsN-terminal 2xStrep-Tag IIExpressionMammalianMutationAmino acid K435 mutated to alaninePromoterCMVAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only