We narrowed to 25,245 results for: promoter
-
Plasmid#235760PurposeExpression of ScVPS38 delta BARA2 (320-440)-x3FLAG under its own promoterDepositorInsertVSP38 delta BARA2
Tags3xFLAGExpressionYeastMutationaa 320-440 deletedPromoterScVPS38 promoterAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO765
Plasmid#235762PurposeExpression of ScVPS38 delta C2 (1-154) -EGFP under its own promoterDepositorInsertVPS38
TagsEGFPExpressionYeastMutationaa 1-154 deletedPromoterScVPS38 promoterAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO766
Plasmid#235763PurposeExpression of ScVPS38 delta BARA2 (320-440)-EGFP under its own promoterDepositorInsertVSP38 delta BARA2
TagsEGFPExpressionYeastMutationaa 320-440 deletedPromoterScVPS38 promoterAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO933
Plasmid#235765PurposeExpression of ScVPS34 delta C154-V202-3xFLAG under its own promoterDepositorInsertVPS34 delta C154-V202
Tags3xFLAGExpressionYeastMutationaa 154-202 deletedPromoterScVPS34 promoterAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-mTSP15
Plasmid#236542PurposeFor expression of Tspan15 in mammalian cellsDepositorAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-sggfp(A)
Plasmid#236039PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(A) expresses the dCas12a endonuclease and the sgRNA (design A) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
p3A3-HA
Plasmid#234806PurposeMammalian expression of bovine arrestin-3 with C-terminal HA tagDepositorAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
p3A3-Flag
Plasmid#234805PurposeMammalian expression of bovine arrestin-3 with C-terminal Flag tagDepositorAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-TO-g0 (FLP-IN)
Plasmid#236120PurposePlasmid encoding g0 guide RNA under control of CMV promoter with two TetR binding sites, used to equalize plasmid masses for transfectionDepositorInsertg0
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW434 4x(ZNF35/ZNF35tar)-SFFV-GFP
Plasmid#236143PurposeFluorescent reporter encoding GFP under control of SFFV promoter with four ZNF35/ZNF35 binding sites upstreamDepositorInsertEGFP
ExpressionMammalianPromoterSFFV promoter with four ZNF35/ZNF35 binding sites…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW435 4x(ZNF35/IKZF1tar)-SFFV-GFP
Plasmid#236144PurposeFluorescent reporter encoding GFP under control of SFFV promoter with four ZNF35/IKZF1 binding sites upstreamDepositorInsertEGFP
ExpressionMammalianPromoterSFFV promoter with four ZNF35/IKZF1 binding sites…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW420 4x(ZNF35/ZNF250tarv3)-SFFV-GFP
Plasmid#236139PurposeFluorescent reporter encoding GFP under control of SFFV promoter with four ZNF35/ZNF250 binding sites upstreamDepositorInsertEGFP
ExpressionMammalianPromoterSFFV promoter with four ZNF35/ZNF250 binding site…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xPax7gRNA
Plasmid#224570PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-3xGFP11-mem-3xPax7gRNA
Plasmid#224571PurposeUbiquitous expression plasmid with CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage, three membrane split GFP(11) reporter.DepositorInsert3xGFP11
UseCRISPRTagsMembrane Localization SignalMutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-2O-crBFP_EF1a-BFP
Plasmid#224783PurposeBFP-targeting crRNA for RfxCas13d expressed from hU6-2xTetO promoter and target BFP protein expressed from EF1a promoterDepositorInsertcrBFP
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6-2xTetOAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-2O-crEGFP_EF1a-BFP
Plasmid#224784PurposeEGFP targeting crRNA for RfxCas13d expressed from hU6-2xTetO promoter and non-target BFP protein expressed from EF1a promoterDepositorInsertcrEGFP
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6-2xTetOAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-crBFP_EF1a-BFP
Plasmid#224785PurposeBFP targeting crRNA for RfxCas13d expressed from hU6 promoter and target BFP protein expressed from EF1a promoterDepositorInsertcrBFP
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6 and hU6-2xTetOAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-CrEGFP_EF1a-BFP
Plasmid#224786PurposeEGFP targeting crRNA for RfxCas13d expressed from hU6 promoter and non-target BFP protein expressed from EF1a promoterDepositorInsertcrBFP
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6 and hU6-2xTetOAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWR23
Plasmid#202770Purposeepisomal bioluminescent reporter plasmid for S. stipitisDepositorInsertsTEF1 promoter (S. stipitis) (TEF1 S. stipitis (yeast))
coKanMX
ACT1 terminator (S. stipitis)
TDH3 promoter (S. stipitis)
coCBG
ADH2 terminator (S. stipitis)
ARS from S. stipitis chromosome 1
ExpressionYeastAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only