We narrowed to 5,692 results for: org
-
Plasmid#101449PurposeDonor Vector containing ZNF534 transcription factor, part of the Human TFome CollectionDepositorInsertZNF534 (ZNF534 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF347
Plasmid#101454PurposeDonor Vector containing ZNF347 transcription factor, part of the Human TFome CollectionDepositorInsertZNF347 (ZNF347 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF860
Plasmid#101441PurposeDonor Vector containing ZNF860 transcription factor, part of the Human TFome CollectionDepositorInsertZNF860 (ZNF860 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF732
Plasmid#101446PurposeDonor Vector containing ZNF732 transcription factor, part of the Human TFome CollectionDepositorInsertZNF732 (ZNF732 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF705A
Plasmid#101414PurposeDonor Vector containing ZNF705A transcription factor, part of the Human TFome CollectionDepositorInsertZNF705A (ZNF705A Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF749
Plasmid#101460PurposeDonor Vector containing ZNF749 transcription factor, part of the Human TFome CollectionDepositorInsertZNF749 (ZNF749 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR_P4-P1R:PER36modp
Plasmid#128431PurposeGateway (Invitrogen) promoter clone (pDONR_P4-P1R) with premature stop codons introduced within the Xero1 and Xero2 genes in the PER36 promoter entry clone (Kunieda et al. 2013).DepositorInsertPEROXISADE36 (AT3G50990 Mustard Weed)
UseGateway promoter entry cloneMutationPremature stop codons introduced into the Xero1 (…PromoterPEROXISADE36Available SinceOct. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pX330-FOXL2-cterm
Plasmid#192893PurposeExpresses Cas9 and sgRNA targeting the C-terminus region of FOXL2DepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Flag-PGC-1alpha1
Plasmid#45501DepositorInsertPGC-1alpha Isoform1 (Ppargc1a Mouse)
Tags6xHis and FlagExpressionMammalianMutationQ339K relative to NM_008904Available SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DIO-EF1α-mKate2-PDE4D3-Cat
Plasmid#169128PurposeAAV plasmid containing a mKate2 and a truncated PDE4D3DepositorHas ServiceAAV1InsertmKate2-PDE4DCatL (PDE4D Human)
UseAAV and Cre/LoxTagsmKate2ExpressionMammalianMutationtruncated, Catalatic domain onlyPromoterEF1aAvailable SinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRSET OCaMP
Plasmid#224932PurposeExpresses OCaMP, an orange calcium indicator, in bacteria. Contains T7 promoter and RSET leader sequence peptide (His tag, T7 leader, Xpress epitope)DepositorInsertOCaMP
Tags6xHis, RSET peptide, and Xpress tagExpressionBacterialPromoterT7Available SinceJuly 28, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-GRAB-HaloDAmut-IRES-EGFP-CAAX
Plasmid#234411PurposeExpresses the chemigenetic dopamine (DA) control sensor GRAB_HaloDAmut and a membrane-localized EGFP in mammalian cellsDepositorInsertGPCR activation based chemigenetic dopamine (DA) control sensor GRAB_HaloDAmut
ExpressionMammalianPromoterCMVAvailable SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-HNF1A-WT-Flag-UTR
Plasmid#183237PurposeExpression of FLAG tagged HNF1ADepositorAvailable SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-RP-CoV2/RBD-puro
Plasmid#161793PurposeTransposon-based SARS-CoV-2 RBD stable expression vector for protein productionDepositorInsertSARS-CoV-2 RBD
UseTransposonTags6xHis and dTomatoExpressionMammalianPromoterEF1a/RPBSAAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER-21-LCOR-P2A-HOXA9-T2A-HOXA5
Plasmid#97044PurposeExpresses LCOR, P2A, HOXA9, T2A and HOXA5 in mammalian cells. *Please see notes below on P2A cleaving efficiency.DepositorInsertLigand Dependent Nuclear Receptor Corepressor, Runt-related transcription factor 1, ETS-related gene
UseLentiviralExpressionMammalianPromoterTet onAvailable SinceSept. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL2 HNF4A P2 wt
Plasmid#60324PurposeHNF4A P2 promoter cloned into the pGL2-basic backbone.DepositorAvailable SinceJan. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
retro-gfp-puro vector
Plasmid#58249PurposeRetroviral expression vector encoding bicistronic EGFP and Puromycin cassetteDepositorInsertEGFP
UseRetroviralExpressionMammalianAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-RP-CoV2/stSpike-puro
Plasmid#161794PurposeTransposon-based SARS-CoV-2 secretable trimeric Spike stable expression vector for protein productionDepositorInsertSARS-CoV-2 secretable trimeric Spike
UseTransposonTags6xHis and dTomatoExpressionMammalianPromoterEF1a/RPBSAAvailable SinceAug. 10, 2021AvailabilityAcademic Institutions and Nonprofits only