We narrowed to 3,184 results for: GRI
-
Plasmid#221402PurposeMammalian expression of human integrin beta1 Q280* full-lengthDepositorInsertintegrin beta1 Q280* full-length (ITGB1 Human)
TagsCD33 secretion peptide (MPLLLLLPLLWAGALA) and HA …ExpressionMammalianMutationcodon-optimized mature sequenceAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Beta1 K418* full-length
Plasmid#221403PurposeMammalian expression of human integrin beta1 K418* full-lengthDepositorInsertintegrin beta1 K418* full-length (ITGB1 Human)
TagsCD33 secretion peptide (MPLLLLLPLLWAGALA) and HA …ExpressionMammalianMutationcodon-optimized mature sequenceAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Beta1 N391* full-length
Plasmid#221404PurposeMammalian expression of human integrin beta1 N391* full-lengthDepositorInsertintegrin beta1 N391* full-length (ITGB1 Human)
TagsCD33 secretion peptide (MPLLLLLPLLWAGALA) and HA …ExpressionMammalianMutationcodon-optimized mature sequenceAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Beta1 N562* full-length
Plasmid#221405PurposeMammalian expression of human integrin beta1 N562* full-lengthDepositorInsertintegrin beta1 N562* full-length (ITGB1 Human)
TagsCD33 secretion peptide (MPLLLLLPLLWAGALA) and HA …ExpressionMammalianMutationcodon-optimized mature sequenceAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
mouse b5 full length
Plasmid#217815PurposeFull length mouse integrin b5 expressionDepositorAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
mouse av full length
Plasmid#217809PurposeFull length mouse integrin av expressionDepositorAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
mouse a2b full length
Plasmid#217812PurposeFull length mouse integrin a2b expressionDepositorAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
human a5 full length
Plasmid#217818PurposeFull length human integrin a5 expressionDepositorAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only