We narrowed to 9,829 results for: CAG
-
Plasmid#86127PurposeLentiviral vector expressing Cas9 and an sgRNA targeting PREX1DepositorAvailable sinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pJK01_Rho_minprox_DsREd
Plasmid#173489PurposePCR template for reporter gene with mouse Rhodopsin promoter with DsRedDepositorInsertMouse Rhodopsin promoter driving DsRed reporter gene
ExpressionMammalianPromoterMouse RhodopsinAvailable sinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shYAP1-1
Plasmid#193692PurposeConstitutive lentiviral expression of YAP1 shRNADepositorInsertYAP1 (YAP1 Human)
UseLentiviralAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
SETD2(SET)-Cas9
Plasmid#186700PurposePlasmid encoding SETD2-Cas9 fusion under CMV promoterDepositorInsertSETD2(SET)-Cas9
UseCRISPRTagsFLAGExpressionMammalianPromoterCMVAvailable sinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_Dual_pegRNA
Plasmid#173199PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 Q118R-G4 pegRNA with a user-specified pegRNA from two independent U6 promoters. pU6-pegRNA-GG-acceptor-like plasmidDepositorInsertATP1A1 G4 Q118R pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-shWRN1
Plasmid#125781Purposeconstitutive expression of a short-hairpin RNA targeting human WRNDepositorInsertshWRN1 (WRN Human)
UseRNAiAvailable sinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA-RNF34
Plasmid#119938PurposeRING finger protein 34 expression (HA-tag at the N-terminus)DepositorAvailable sinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCR-U6-gRNA-miniCMV-TdTomato
Plasmid#192656PurposeA plasmid encoding miniCMV sgRNA and miniCMV-promoter-TdTomatoDepositorInsertTdTomato
ExpressionMammalianPromoterU6, miniCMVAvailable sinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-WIPI2d-TEVcs-TSF
Plasmid#171420PurposeFor the purifcation of GFP- WIPI2d proteinDepositorInsertWIPI2d (WIPI2 Human)
ExpressionMammalianAvailable sinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgACSL4 clone1
Plasmid#162128PurposeLentiviral sgRNA plasmid targeting human ACSL4DepositorInsertsgACSL4 (ACSL4 Human)
UseLentiviralAvailable sinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shFXN_2
Plasmid#102971PurposeSuppression of FXNDepositorInsertshFXN_2 (FXN Human)
UseLentiviral and RNAiAvailable sinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD051-sgMLH1-1
Plasmid#125776Purposeconstitutive expression of a guide RNA targeting human MLH1 (CRISPR cutting control) and S. pyogenes Cas9DepositorInsertsgMLH1-1 (MLH1 Human)
UseCRISPRAvailable sinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD051-sgMLH1-2
Plasmid#125777Purposeconstitutive expression of a guide RNA targeting human MLH1 (CRISPR cutting control) and S. pyogenes Cas9DepositorInsertsgMLH1-2 (MLH1 Human)
UseCRISPRAvailable sinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-intein/Src
Plasmid#71406PurposeExpresses Src inserted with a Npu DnaE intein (F1 construct)DepositorInsertSrc active kinase domain inserted with Npu DnaE intein
ExpressionMammalianPromoterpCMVAvailable sinceJan. 27, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSuper.Retro.Puro-PKN1 shRNA 4
Plasmid#59978PurposeKnockdown of PKN1DepositorInsertPKN1 shRNA
UseRetroviralAvailable sinceOct. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hif-1-sgRNA-B
Plasmid#177785PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hif-1 promoter)DepositorInserthif-1 (hif-1 Nematode)
ExpressionBacterialAvailable sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRSITEP-puro-shWRN1-C911
Plasmid#125784Purposea seed-matched control for pRSITEP-puro-shWRN1DepositorInsertshWRN1-C911 (WRN Human)
UseRNAiAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by