We narrowed to 5,947 results for: crispr cas9 expression plasmids
-
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABEmax-SpRY
Plasmid#195279PurposeAllows for in vitro transcription of original pCMV-T7-ABEmax(7.10)-SpRY-P2A-EGFP (RTW5025) without EGFPDepositorInserthuman codon optimized ABEmax(7.10) SpCas9 variant named SpRY without EGFP
ExpressionMammalianPromoterCMVAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABEmax-SpG
Plasmid#195278PurposeAllows for in vitro transcription of original pCMV-T7-ABEmax(7.10)-SpG-P2A-EGFP (RTW4562) without EGFPDepositorInserthuman codon optimized ABEmax(7.10) SpCas9 variant named SpG without EGFP
ExpressionMammalianPromoterCMVAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
DBJS-p2.13
Plasmid#246892PurposeA human codon-optimized SpCas9 and chimeric guide RNA expression plasmid encoding guide for G3BP2 Nterm.DepositorInsertG3BP2 Nterm Guide RNA 1 (G3BP2 Human)
ExpressionMammalianAvailable SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
Orco-T2A-QF2-9xQUAS-GCaMP6f-3XP3-dsRed
Plasmid#157974PurposeTemplate plasmid for inserting GCaMP reporter into the Orco gene of Aedes aegypti with CRISPR/Cas9DepositorInsertOrco
ExpressionInsectAvailable SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX4
Plasmid#183903Purposedonor plasmid for CRISPR Cas9 knockin near the Aedes aegypti m / M locusDepositorInsertGFP
ExpressionInsectPromoterAedes aegypti PUbAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gLacZ.EFS-NS.H2B-RFP
Plasmid#170363PurposeNegative control plasmid used for Crispr/cas9 based disruption. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralPromoterEFS-NSAvailable SinceJune 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP
Plasmid#112677PurposeAn AAV vector that expresses a Cre-dependent nuclear-localized Red to Green Fluorescent proteinDepositorHas ServiceAAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertNuclear-localized floxed-mCherry EGFP
UseAAVTagsNuclear localization signalPromoterEF1aAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV_ACTB CRISPIE
Plasmid#172853PurposeActb sgRNA & DRS-2 sgRNA expression under U6. CRISPIE donor mEGFP phase (0-0), excised by DRS-1 or DRS-2 (with SpCas9). Also expresses mRuby3 under the CBA promotor. See Zhong et al, eLife 2021.DepositorInsertsActb intron 1 sgRNA
DRS-2 sgRNA
CRISPIE designer exon (phase 0-0) encoding mEGFP
mRuby3
UseAAV and CRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only