We narrowed to 23,913 results for: promoter
-
Plasmid#65461Purposecontaining 1.3 units of the X-null HBV genome (subtype ayw)DepositorInsert1.3 units of the X-null HBV genome
ExpressionMammalianAvailable SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pVRa28_1088
Plasmid#49683DepositorInsertECF28_1088
UseSynthetic BiologyTagsHis6-PreScissionExpressionBacterialMutationCodon optimized for E.coliPromoterpT7-lacOAvailable SinceJan. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
pLenti-puro-ARID1A
Plasmid#39478PurposeTetracycline-inducible lentiviral expression of human ARID1A; 3rd generation lentiviral vectorDepositorAvailable SinceSept. 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pGMβ1
Plasmid#216202PurposeChromosomal gene manipulation (gene insertion, conversion, deletion) of dairy used Lactobacillus bulgaricus, a difficult gene to manipulate, is now possible by conjugation using this pGMB1 plasmid.DepositorTypeEmpty backboneUseShuttle vector, conjugal plasmid, theta type rep…ExpressionBacterialPromoterlac promoter in pGEM-Teasy, Promoters in pAMbeta1…Available SinceJan. 21, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCryptDel4.8
Plasmid#141293PurposePlasmid for curing pMUT2 in one step based on pFREE. Contains RelB antitoxin, as well as gRNA targetting pMUT2 plasmid as well as pCryptDel4.8 itself.DepositorInsertsRelB
gRNA targetting pMUT2
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterNative promoter from pMUT2 relB/relE operon and P…Available SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBabe puro c-met WT
Plasmid#17493DepositorAvailable SinceMarch 12, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCF1148
Plasmid#222330PurposeFluorescent reporter plasmid for VeillonellaDepositorInsertbs2 gene with Veillonella parvula SKV38 mdh promoter
UseE. coli-veillonella shuttle plasmidExpressionBacterialPromoterVeillonella parvula SKV38 mdh promoterAvailable SinceOct. 31, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pWN_U6-TRAC-miniGag-Cas9
Plasmid#228959PurposeminiEDV production plasmid. Expresses the miniGag-Cas9 polypeptide (CAG promoter) and sgRNA (human U6 promoter)DepositorInsertminiGag-Cas9
UseCRISPRExpressionMammalianAvailable SinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL
Plasmid#196286Purpose35S promoter-driven expression of the positive-sense TSWV L RNA segment encoding codon-optimized L (RdRp)DepositorInsertFull length TSWV L antigenome encoding codon-optimized L (RdRp)
UseCRISPRExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNAHA
Plasmid#44169DepositorInsertshemagglutinin gene
neuraminidase gene
ExpressionMammalianMutationT55APromoterCMV enhancer/human Ferritin light chain promoter …Available SinceMay 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
LcV2-Hygro
Plasmid#91977PurposeLentiCRISPR v2 with Hygro cloned in place of PuroDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2pA2-9xGRE
Plasmid#74736PurposeGRE-dependent EGFP reporter construct flanked by the minimal Tol2 transposon elementsDepositorInsertEGFP
UseZebrafish expressionPromoternine GC-responsive elements (9xGRE) from the rat …Available SinceApril 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9-P2A-EGFP (RTW3027)
Plasmid#139987PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9 with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9 with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianPromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLVET-IRES-GFP
Plasmid#107139PurposeA bicistronic lentiviral mammalian expression vector with a multiple cloning site and GFPDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
LRG2.1_Neo
Plasmid#125593PurposeLentiviral expression of sgRNA with GFP and neomycin resistance geneDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 promoter for sgRNA expression and EFS promoter…Available SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLUT7 HA-GLI1
Plasmid#62970PurposeExpresses HA-tagged Gli1DepositorAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
PL-SIN-Oct4-EGFP
Plasmid#21319PurposeLentiviral vector, expresses EGFP under Oct3/4 promoterDepositorInsertEnhanced Green Fluorescence Protein
UseLentiviralExpressionMammalianPromoterOct-4 promoter regionAvailable SinceJune 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
pSL0284 (pQCascade_entry)
Plasmid#130635PurposeExpresses V. cholerae CAST TniQ, Cas8, Cas7, and Cas6 from one T7 promoter, and a CRISPR RNA from a second T7 promoter. The CRISPR array contains two BsaI sites for spacer cloning.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, CRISPR(entry)
UseCRISPR; TransposonExpressionBacterialPromoterT7Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only