We narrowed to 10,133 results for: Uty
-
Plasmid#162502PurposeExpresses a ST6GAL1 mutant with a GFP tag in its C-terminus in mammalian cells. The mutated stem region of Tac is inserted within ST.DepositorTagsGFPExpressionMammalianMutationThe mutated Tac stem region is inserted within ST…Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only
-
GFP-Tac-STC(5A)
Plasmid#162491PurposeExpresses non-O-glycosylated partial length Tac (stem region, TMD and cytosolic tail) with GFP tag in mammalian cellsDepositorInsertpartial length Tac (stem region with mutations, TMD and cytosolic tail) (IL2RA Human)
TagsGFPExpressionMammalianMutationTac is in partial length with its stem region, TM…Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_6
Plasmid#155064PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_5
Plasmid#155063PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_3
Plasmid#155061PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_2
Plasmid#155060PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and an intergenic site & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR_P4-P1R:PER36modp
Plasmid#128431PurposeGateway (Invitrogen) promoter clone (pDONR_P4-P1R) with premature stop codons introduced within the Xero1 and Xero2 genes in the PER36 promoter entry clone (Kunieda et al. 2013).DepositorInsertPEROXISADE36 (AT3G50990 Mustard Weed)
UseGateway promoter entry cloneMutationPremature stop codons introduced into the Xero1 (…PromoterPEROXISADE36Available SinceOct. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKLV2-U6gRNA5(Apc-g1)-PGKpuroBFP-W
Plasmid#105022PurposeLentiviral gRNA plasmid targeting mouse Apc , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Hgs-g1)-PGKpuroBFP-W
Plasmid#105032PurposeLentiviral gRNA plasmid targeting mouse Hgs , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2delta
Plasmid#124154PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1alpha
Plasmid#124147PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1beta
Plasmid#124148PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1gamma
Plasmid#124149PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2alpha
Plasmid#124151PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2beta
Plasmid#124152PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2gamma
Plasmid#124153PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 (-) hYAP 1-1beta
Plasmid#124140PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG3_VPEVS
Plasmid#105863PurposeExpression plasmid coding for mutated heavy chain of mouse IgG3 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody has mutated 5 amino acids in lower hinge.DepositorInsertIgG3 heavy chain (Ighg3 Mouse)
ExpressionMammalianMutationmutated heavy chain of mouse IgG3 with five mutat…PromoterhEF1-HTLV promAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only