We narrowed to 7,067 results for: FIE
-
Plasmid#246950PurposeExpresses multifunctional construct for AND-gated release of mCherry from materials in response to 405 nm light AND sortase eSrtA(2A9) treatment. Contains a SpyTag for material tethering.DepositorInsertPlease see depositor comments below
Tags6x His tag, SsrAExpressionBacterialAvailable SinceNov. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGTPA-lb
Plasmid#171528PurposePlasmid contains the Cas12k gRNA for mutant library constructionDepositorInsertCas12k gRNA
UseCRISPRPromoterConstitutive promoter J23119Available SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXJ-Myc-GATA3
Plasmid#232646Purposetransient expresses GATA3 in mammalian cellsDepositorAvailable SinceMarch 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3_5UTR_Myc_FLuc Compensatory Mutant
Plasmid#229504PurposeMyc 5' untranslated region firefly luciferase reporter with compensatory mutations in the region bound by RBM42DepositorInsertMyc 5'UTR_CompMutant
ExpressionMammalianMutationMutations in bp 363-394PromoterSV40Available SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pBAD02_CBASS_Methylosarcina_fibrata
Plasmid#224406PurposeFor expression of the type I CBASS system encoded by Methylosarcina fibrataDepositorInsert4TM_MfCdnH_AGS-C
ExpressionBacterialAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBAD02_CBASS_Stenotrophomonas_maltophilia
Plasmid#224396PurposeFor expression of the type I CBASS system encoded by Stenotrophomonas maltophiliaDepositorInsertCap4_SmCdnD
ExpressionBacterialAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBAD02_CBASS_Escherichia_albertii
Plasmid#224390PurposeFor expression of the type I CBASS system encoded by Escherichia albertiiDepositorInsertEaCdnB_Cap15
ExpressionBacterialAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
CBLa_1.2_GpA_G83I
Plasmid#207845PurposeBLaTM-System GpA G83I negative control in CBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR3cDual-Wnk
Plasmid#203976PurposeEnrty clone for Gateway cloningDepositorInsertWnk (Wnk Fly)
UseUnspecifiedAvailable SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IRES-puro-3xFLAG
Plasmid#204545PurposeExpresses 3xFLAG tag in mammalian cellsDepositorInsert3xFlag
UseRetroviralExpressionMammalianMutationNoneAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only