We narrowed to 5,895 results for: SUP
-
Plasmid#145176PurposeMammalian expression plasmid for sACE2-sfGFP high affinity variant 5DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsLinker GSGGSGSGG and superfolder GFPExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable SinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2v4-sfGFP
Plasmid#145175PurposeMammalian expression plasmid for sACE2-sfGFP high affinity variant 4DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsLinker GSGGSGSGG and superfolder GFPExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable SinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2v2.2-sfGFP
Plasmid#149665PurposeMammalian expression plasmid for sACE2-sfGFP high affinity variant 2.2DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsLinker GSGGSGSGG and superfolder GFPExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2-T92Q-sfGFP
Plasmid#145178PurposeMammalian expression plasmid for sACE2-sfGFP glycosylation mutant T92QDepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsLinker GSGGSGSGG and superfolder GFPExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable SinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
SOBIR1 X010_pECIA2
Plasmid#115075PurposeBait vector SOBIR1 X010_pECIA2 should be used with prey vector SOBIR1 X010_pECIA14.DepositorInsertAT2G31880 (SOBIR1 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
SOBIR1 X010_pECIA14
Plasmid#114875PurposePrey vector SOBIR1 X010_pECIA14 should be used with bait vector SOBIR1 X010_pECIA2.DepositorInsertAT2G31880 (SOBIR1 Mustard Weed)
ExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-CMV-mCherry-1xU6-LeuIGI2
Plasmid#217368PurposeExpresses E. coli leucine tRNA variant "LeuIGI2" and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertE. coli leucine tRNA mutant, "LeuIGI2" for TAG suppression
UseAAVExpressionMammalianMutationC2G, C3G, G6U, A7G, U77C, C78G, G81C, G82C, U83CPromoterU6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-KSR1-CA3 (N-KSR)
Plasmid#217755PurposeFluorescent reporter for glucosyl-ceramide (putative, mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
TagsEGFPExpressionMammalianMutationCA3 domain aa 317-400PromoterCMVAvailable SinceJune 11, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKSR1-CA3-GS-mRFP1 (C-KSR-GS)
Plasmid#217758PurposeFluorescent reporter for ceramide (mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
TagsmRFPExpressionMammalianMutationCA3 domain aa 317-400 with GGSSGGGGA linkerPromoterCMVAvailable SinceJune 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKSR1-CA3-GS-EGFP (C-KSR-GS)
Plasmid#217757PurposeFluorescent reporter for ceramide (mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
TagsEGFPExpressionMammalianMutationCA3 domain aa 317-400 with GGSSGGGGA linkerPromoterCMVAvailable SinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
TFORF0344
Plasmid#141587PurposeLentiviral vector for overexpressing the ETF1 transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0343
Plasmid#141586PurposeLentiviral vector for overexpressing the ETF1 transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0342
Plasmid#141585PurposeLentiviral vector for overexpressing the ETF1 transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnEA-vH_His-TEV-DSep1-msfGFP
Plasmid#174494Purposebacterial expression of Drosophila Sep1 fused to monomeric superfolder GFPDepositorAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRIPZ-bioGEF-UBnc-PURO
Plasmid#208044PurposeEnables inducible expression of low-affinity Avitag-UBnc; to perform bioE3; nc = non-cleavable mutation; selection with puromycinDepositorInsertUBnc (UBC Human)
UseLentiviralTagsLow-affinity AvitagMutationL73P Mutation near C-terminus suppresses cleavage…PromotertetO/UBCAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_U6 tRNAPyl_CMV NESPylRS(AF)_IRES_eRF1(E55D)-HA
Plasmid#182653PurposeEncodes codon-optimized AF mutant of M. mazei pyrrolysine (Pyl) tRNA synthetase fused to a nuclear export signal (NESPylRSAF),tRNACUAPyl & eRF1E55D used for amber codon suppression in mammalian cellsDepositorInsertscodon-optimized Y306A/Y384F (AF) double mutant of Methanosarcina mazei-derived pyrrolysine (Pyl) tRNA synthetase
PylT
mutant eukaryotic release factor 1
TagsHA tag and nuclear export signal (NES)ExpressionMammalianMutationE55D and Y306A/Y384F (AF) double mutant of Methan…PromoterCMV and U6Available SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc msfGFPΔC9-LifeactΔN2
Plasmid#231556PurposeMammalian expression of N-terminally truncated Lifeact fused to C-terminally truncated monomeric superfolder GFP for actin filament organization measurements using fluorescence polarization microscopyDepositorAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRIPZ-CTID195-GSQ-UBnc-PURO
Plasmid#208037PurposeEnables inducible expression of C-terminal Split-TurboID-fused UBnc, to perform Ubiquitin-ID; nc = non-cleavable mutation; selection with puromycinDepositorInsertUbnc (UBC Human)
UseLentiviralTagsMyc, C-terminal Split-TurboIDMutationL73P Mutation near C-terminus suppresses cleavage…PromotertetO/UBCAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-EGFP-PA-BAX(mito, G108V)
Plasmid#233343PurposeStable expression of EGFP-LOV2(N538E)-BAX(G108V)-OMP25 in mammalian cells. The G108V mutation suppresses pore-forming activity of BAX.DepositorUseRetroviralTagsEGFPExpressionMammalianMutationN-terminus and C-terminus are deleted. BAX(3-171)…Available SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only