We narrowed to 9,951 results for: Uty
-
Plasmid#51435PurposeThis plasmid is a luciferase-based reporter construct to measure the activity of the ApoE promoter fused to ME.1 enhancerDepositorUseLuciferaseExpressionMammalianMutationME.1 enhancer is fused upstream of ApoE promoter …Available SinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only
-
pKLV2-U6gRNA3(BbsI)-PGKpuro2ABFP
Plasmid#67990PurposeCRISPR gRNA expression vector with the conventional scaffold and puro/BFP markers without WPREDepositorInsertU6gRNA cassette with the conventional scaffold, PGKpuro2ABFP cassette
UseCRISPR and LentiviralAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-Archon1-KGC-EGFP-ER2
Plasmid#108422PurposeAAV production plasmid encoding for Archon1 fluorescent voltage reporter, Cre-dependent expressionDepositorHas ServiceAAV5InsertArchon1-KGC-EGFP-ER2
UseAAV and Cre/LoxExpressionMammalianPromoterCAGAvailable SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBK2045-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2(CMV-gRNA1)
Plasmid#223165Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting CMVDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-BlastR [M1G]
Plasmid#171805PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein and blasticidin resistance cassette [p.M1G]DepositorInsertmNeonGreen-T2A-BlastR
UseGene taggingMutationBlastR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmiRFP-alpha-Tubulin-19-C
Plasmid#108413PurposeAlpha-tubulin fused to monomeric near-infrared fluorescent protein miRFPDepositorAvailable SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEx-iSeroSnFR
Plasmid#128486PurposeFluorescent reporter for serotonin (conditional + membrane localization tag)DepositorHas ServiceAAV9InsertiSeroSnFR
UseAAVTagsIg-kappa leader, Myc, PDGFR, and cpsfGFPExpressionMammalianPromoterCAGAvailable SinceDec. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
CMV ArcLightCo (Q239)-T2A-nls-mCherry
Plasmid#85806PurposeGenetically encoded voltage sensor ArcLight- codon optimizedDepositorInsertArcLightCo-Q239
TagsmCherryExpressionMammalianMutationCi-VSP contains R217Q mutation; super ecliptic pH…PromoterCMVAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pmiRFP-Vimentin-17-C
Plasmid#108414PurposeVimentin fused to monomeric near-infrared fluorescent protein miRFPDepositorAvailable SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSAD-5PSD95-EGFP-SynPhRFP
Plasmid#217979PurposeG-Deleted Rabies genomic plasmid to express 5PSD95-EGFP and SynPhRFPDepositorUseG-deleted rabiesTagsEGFP and RFPPromoterNoneAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-(Spyo_Cas9)-6xHis-NLS(SV40)
Plasmid#185706PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(Spyo_Cas9) with an N-terminal NLS and C-terminal NLSDepositorInsertCas9
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOPINO_H3
Plasmid#171927PurposeBacterial expression of nanobody VHH_H3, which binds to receptor binding domain of the spike protein of SARS-CoV-2DepositorInsertVHH_H3
TagsHis6ExpressionBacterial and MammalianAvailable SinceSept. 23, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLenti GW V5 Eco/Dam hum LaminA
Plasmid#182673PurposeLentiviral eukaryotic expression vector with E.Coli Dam methylation fused to human Lamin A. Used in DamID experiments to methylate DNA that interacts in the proximity of Lamin A.DepositorInsertLamin A (LMNA Human)
UseLentiviralTagsE. Coli Dam and V5ExpressionMammalianPromoterHSPAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
JDW 743 (pDONR221-EYFP-hKRAS4B-WT)
Plasmid#156402PurposeGateway middle entry clone encoding EYFP-fused to human KRAS4B, includes a stop codonDepositorAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-Archon1-KGC-EGFP-ER2
Plasmid#108419PurposeAAV production plasmid encoding for Archon1 fluorescent voltage reporterDepositorInsertArchon1-KGC-EGFP-ER2
UseAAVExpressionMammalianPromoterCaMKIIAvailable SinceApril 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBK2047-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA2)
Plasmid#223167Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and gRNA2 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSt1374m-EF1alpha-N-NLS-DNMT3L-L-DNMT3A-L-dcas9-NLS
Plasmid#112214PurposeTargeted DNA methylationDepositorUseCRISPRTagsmCherryMutationD10A,H840A,N863AAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
px335 Mettl14 sgRNA #2
Plasmid#61514Purposeencodes sgRNA sequence for targeting mouse Mettl14 locus (Cas9-Nickase strategy)DepositorInsertgccgctcccggatctcctgc
UseCRISPRExpressionMammalianAvailable SinceJan. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pOPINO_C5
Plasmid#171925PurposeBacterial expression of nanobody VHH_C5, which binds to receptor binding domain of the spike protein of SARS-CoV-2DepositorInsertVHH_C5
TagsHis6ExpressionBacterialAvailable SinceSept. 23, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits