Skip to main content

We narrowed to 13,875 results for: cas9

Showing: 11801 - 11840 of 13875 results
  1. pCRISPRi_Mxi1_yl

    Plasmid
    #91248
    Purpose
    CRISPR-dCas9-Mxi1 vector for Yarrowia lipolytica, expressing dCas9-Mxi1 and AvrII site for sgRNA insertion
    Depositor
    Inserts
    Codon optimized dCas9-Mxi1
    sgRNA expression cassette
    Use
    CRISPR and Synthetic Biology
    Expression
    Yeast
    Promoter
    SCR1'-tRNA and UAS1B8-TEF(136)
    Available Since
    Aug. 25, 2017
    Availability
    Academic Institutions and Nonprofits only
  2. pYPQ265E9

    Plasmid
    #213472
    Purpose
    Gateway entry clone (attL1 & attR5) TadDE-32aa linker-zSpCas9-D10A-2xUGI for C-T and A to G base editing
    Depositor
    Insert
    TadDE-32aa linker-zSpCas9-D10A-2xUGI
    Use
    CRISPR; Gateway compatible tadde-32aa linker-zspc…
    Tags
    NO
    Expression
    Plant
    Available Since
    May 20, 2024
    Availability
    Academic Institutions and Nonprofits only
  3. ACBE

    Plasmid
    #204607
    Purpose
    Mammalian expression of adenine-to-cytosine base editor ACBE
    Depositor
    Insert
    bpNLS-N terminal of nSpCas9-linker-mAAG (R165E/Y179F)-TadA-8e-linker-C terminal of nSpCas9-bpNLS-P2A-GFP
    Use
    CRISPR
    Tags
    6*His
    Expression
    Mammalian
    Mutation
    mAAG (R165E/Y179F); S. pyogenes Cas9 (D10A)
    Available Since
    Aug. 15, 2023
    Availability
    Academic Institutions and Nonprofits only
  4. GFP-itis pBE-t

    Plasmid
    #195342
    Purpose
    Base editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110V
    Depositor
    Inserts
    ecTadA(8e)-SpCas9-NG
    gRNA ctctacgcgggtcttgtagt
    Use
    CRISPR
    Mutation
    SpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…
    Promoter
    Lac and ProC
    Available Since
    Jan. 31, 2023
    Availability
    Academic Institutions and Nonprofits only
  5. GFP-itis pBE-nt

    Plasmid
    #195343
    Purpose
    Base editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNA
    Depositor
    Inserts
    ecTadA(8e)-SpCas9-NG
    gRNA gtgcacgacgccgtatgcga
    Use
    CRISPR
    Mutation
    SpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…
    Promoter
    Lac and ProC
    Available Since
    Jan. 31, 2023
    Availability
    Academic Institutions and Nonprofits only
  6. pYPQ266E

    Plasmid
    #161521
    Purpose
    Gateway entry clone (attL1 & attR5) for CRISPR-zSpRYCas9 PmCDA1 mediated C-T base editing
    Depositor
    Insert
    zSpRYCas9(D10A)-PmCDA1-UGI
    Use
    CRISPR; Gateway compatible zsprycas9(d10a)-pmcda1…
    Tags
    3X FLAG, NLS
    Expression
    Plant
    Available Since
    Feb. 26, 2021
    Availability
    Academic Institutions and Nonprofits only
  7. pYPQ265E6

    Plasmid
    #213469
    Purpose
    Gateway entry clone (attL1 & attR5) TadA-CDa-32aa linker-zSpCas9-D10A-2xUGI for C-T base editing
    Depositor
    Insert
    TadA-CDa-32aa linker-zSpCas9-D10A-2xUGI
    Use
    CRISPR; Gateway compatible tada-cda-32aa linker-z…
    Tags
    No
    Expression
    Plant
    Available Since
    May 20, 2024
    Availability
    Academic Institutions and Nonprofits only
  8. pYPQ265F2

    Plasmid
    #164722
    Purpose
    Gateway entry clone (attL1 & attR5) A3A/Y130F-nCas9-NG-CBE_V01 for C-T base editing
    Depositor
    Insert
    A3A(Y130F)-zCas9(D10A)NG-UGI
    Use
    CRISPR; Gateway compatible a3a/y130f-ncas9-ng-cbe…
    Expression
    Plant
    Available Since
    May 21, 2021
    Availability
    Academic Institutions and Nonprofits only
  9. pNA0304

    Plasmid
    #165612
    Purpose
    Vector for expression of sgRNAs in yeast: SNR52p-NotI-sgRNA-SUP4t (NotI site in place of the spacer)
    Depositor
    Insert
    SNR52p-NotI-sgRNA-SUP4t (S. cerevisiae SNR52 promoter driving the sgRNA for SpCas9, with a NotI site in place of the spacer)
    Use
    CRISPR
    Expression
    Yeast
    Mutation
    NotI site replaced the CAN1 spacer in parent vect…
    Promoter
    SNR52
    Available Since
    June 10, 2021
    Availability
    Academic Institutions and Nonprofits only
  10. pYPQ262m

    Plasmid
    #161522
    Purpose
    Gateway entry clone (attL1 & attR5) for CRISPR-zSpCas9 ABE7.10 mediated A-G base editing
    Depositor
    Insert
    TadA(wt)-TadA(7.10)-zSpCas9(D10A)
    Use
    CRISPR; Gateway compatible tada(wt)-tada(7.10)-zs…
    Expression
    Plant
    Available Since
    Feb. 26, 2021
    Availability
    Academic Institutions and Nonprofits only
  11. pYPQ265E7

    Plasmid
    #213470
    Purpose
    Gateway entry clone (attL1 & attR5) TadA-CDd-32aa linker-zSpCas9-D10A-2xUGI for C-T base editing
    Depositor
    Insert
    TadA-CDd-32aa linker-zSpCas9-D10A-2xUGI
    Use
    CRISPR; Gateway compatible tada-cdd-32aa linker-z…
    Tags
    No
    Expression
    Plant
    Available Since
    May 20, 2024
    Availability
    Academic Institutions and Nonprofits only
  12. pYPQ265E8

    Plasmid
    #213471
    Purpose
    Gateway entry clone (attL1 & attR5) TadA-CDd_V106W-32aa linker-zSpCas9-D10A-2xUGI for C-T base editing
    Depositor
    Insert
    TadA-CDd_V106W-32aa linker-zSpCas9-D10A-2xUGI
    Use
    CRISPR; Gateway compatible tada-cdd_v106w-32aa li…
    Tags
    No
    Expression
    Plant
    Available Since
    May 20, 2024
    Availability
    Academic Institutions and Nonprofits only
  13. ACBE-Q

    Plasmid
    #204608
    Purpose
    Mammalian expression of high-accuracy adenine-to-cytosine base editor ACBE-Q
    Depositor
    Insert
    bpNLS-N terminal of nSpCas9-linker-mAAG (R165E/Y179F)-TadA-8e (N108Q)-linker-C terminal of nSpCas9-bpNLS-P2A-GFP
    Use
    CRISPR
    Tags
    6*His
    Expression
    Mammalian
    Mutation
    TadA-8e (N108Q); mAAG (R165E/Y179F); S. pyogenes …
    Available Since
    Aug. 15, 2023
    Availability
    Academic Institutions and Nonprofits only
  14. pIA33

    Plasmid
    #120803
    Purpose
    E. coli-C. difficile shuttle vector for CRISPR interference (CRISPRi) in C. difficile; sgRNA targets rfp; Pxyl::dCas9-opt Pgdh::sgRNA-rfp
    Inserts
    deactivated nuclease dCas9, codon-optimized for C. difficile
    single guide RNA targeting red fluorescent protein
    Use
    CRISPR
    Expression
    Bacterial
    Mutation
    Base-pairing region targets red fluorescent prote…
    Promoter
    Pgdh and Pxyl
    Available Since
    Feb. 12, 2019
    Availability
    Academic Institutions and Nonprofits only
  15. pET-PE2-His (IK1822)

    Plasmid
    #170103
    Purpose
    T7 promoter bacterial expression plasmid for PE2 (nSpCas9(H840A)-MMLV-RT) with C-terminal 6xHis-tag and bipartite NLS
    Depositor
    Insert
    bpNLS-nSpCas9(H840A)-MMLVRT-bpNLS-6xHis
    Use
    CRISPR
    Tags
    6xHis tag
    Expression
    Bacterial
    Mutation
    Bacteria codon-optimized nSpCas9 (H840A) & M-…
    Promoter
    T7
    Available Since
    May 13, 2021
    Availability
    Academic Institutions and Nonprofits only
Showing: 11801 - 11840 of 13875 results