We narrowed to 7,378 results for: ESP
-
-
8522-E04
Plasmid#234289PurposeGateway ORF Entry clone of mouse Tgfb1 with stop codon (for native or N-terminal fusions); C223S/C225S mutationsDepositorAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
8522-E05
Plasmid#234290PurposeGateway ORF Entry clone of mouse Tgfb2 with stop codon (for native or N-terminal fusions); C226S/C228S/C229S mutationsDepositorAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGG-PIP72
Plasmid#196810PurposeContains PMR4 promoterDepositorInsertPOWDERY MILDEW RESISTANT 4
UseGreengate (gg) entry vectorAvailable SinceDec. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
Salsa-BC293-P4B1
Plasmid#203134PurposeExpression of barcoded reporter plasmid for PRESTO-Salsa; EGFP/BC293DepositorInsertEGFP/BC293
ExpressionMammalianPromoterTet Response Element (TRE)Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
Salsa-BC170-P2G2
Plasmid#203011PurposeExpression of barcoded reporter plasmid for PRESTO-Salsa; EGFP/BC170DepositorInsertEGFP/BC170
ExpressionMammalianPromoterTet Response Element (TRE)Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
Salsa-BC157-P2F1
Plasmid#202998PurposeExpression of barcoded reporter plasmid for PRESTO-Salsa; EGFP/BC157DepositorInsertEGFP/BC157
ExpressionMammalianPromoterTet Response Element (TRE)Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
Salsa-BC120-P2B12
Plasmid#202961PurposeExpression of barcoded reporter plasmid for PRESTO-Salsa; EGFP/BC120DepositorInsertEGFP/BC120
ExpressionMammalianPromoterTet Response Element (TRE)Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
Salsa-BC121-P2C1
Plasmid#202962PurposeExpression of barcoded reporter plasmid for PRESTO-Salsa; EGFP/BC121DepositorInsertEGFP/BC121
ExpressionMammalianPromoterTet Response Element (TRE)Available SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
Salsa-BC282-P3H6
Plasmid#203123PurposeExpression of barcoded reporter plasmid for PRESTO-Salsa; EGFP/BC282DepositorInsertEGFP/BC282
ExpressionMammalianPromoterTet Response Element (TRE)Available SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
Salsa-BC232-P3D4
Plasmid#203073PurposeExpression of barcoded reporter plasmid for PRESTO-Salsa; EGFP/BC232DepositorInsertEGFP/BC232
ExpressionMammalianPromoterTet Response Element (TRE)Available SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
Salsa-BC216-P3B12
Plasmid#203057PurposeExpression of barcoded reporter plasmid for PRESTO-Salsa; EGFP/BC216DepositorInsertEGFP/BC216
ExpressionMammalianPromoterTet Response Element (TRE)Available SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only
