We narrowed to 105 results for: Folding Reporter GFP
-
Plasmid#191110PurposeAn E. coli sfGFP reporter with one TAG at position 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-V2*D134*
Plasmid#191111PurposeAn E. coli sfGFP reporter with two TAG at positions 2 & 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging V2 & D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJBL7346
Plasmid#217370PurposesfGFP reporter for synthetic transcriptional variant of Pca rhtB ZTP riboswitchDepositorInsertPca rhtB synthetic transcriptional riboswitch sfGFP reporter
Available SinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKrox24(MapERK)d1EGFP (KroxDs)
Plasmid#214912Purposefor PiggyBac mediated integration and stable expression of destabilised EGFP as a reporter to MAPK/ERK pathway activationDepositorInsertd1EGFP under the MapERK promoter
ExpressionMammalianPromoterMapkERK promoterAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ5079_pHR_PGK_sfGFP_CoV-F1
Plasmid#155303PurposeSARS-CoV-2 fluorescent reporter 1DepositorInsertSuperfolder GFP fused with SARS-CoV-F1 (ORF1ab Synthetic)
UseLentiviralExpressionMammalianPromoterPGKAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-V2*D134*Y152*
Plasmid#191112PurposeAn E. coli sfGFP reporter with two TAG at positions 2 & 134 & 152DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging V2 & D134 & Y152 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-25xUPRE-minP-EGFP
Plasmid#159668PurposeEGFP reporter plasmid containing 25 tandem repeats of the the unfolded protein response element (UPRE)DepositorInsert25xUPRE-minP-EGFP
UseLentiviralExpressionMammalianAvailable SinceMarch 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-GFP-PQRv3-RFP
Plasmid#73951PurposeProtein Quantitation Reporter (PQR) to quantify a protein of interest in mammalian cells.DepositorInsertssfGFP (superfolder GFP)
RFP
TagsA residual PQR peptide wii be left at the C-termi…ExpressionMammalianPromoterChicken beta actin and Chicken beta actin (shared…Available SinceJan. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pY71-PT7-RiboJ-sfGFP-MGapt
Plasmid#129119PurposeExpresses a fluorescent reporter for the quantification of cell-free protein expression.DepositorInsertSuperfolder GFP with Malachite Green aptamer
UseSynthetic BiologyTagsHis6 and RiboJ InsulatorExpressionBacterialPromoterT7Available SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJBL7345
Plasmid#217372PurposesfGFP reporter for chimeric riboswitch with Cbe pfl ZTP riboswitch aptamer and WT Pca rhtB ZTP riboswitch expression platformDepositorInsertChimeric ZTP riboswitch with Cbe pfl aptamer and WT Pca rhtB expression platform sfGFP reporter
Available SinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJBL7316
Plasmid#217371PurposesfGFP reporter for chimeric riboswitch with Cbe pfl ZTP riboswitch aptamer and transcriptional variant of Pca rhtB ZTP riboswitch expression platformDepositorInsertChimeric ZTP riboswitch with Cbe pfl aptamer and transcriptional variant of Pca rhtB expression platform sfGFP reporter
Available SinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
HC-M
Plasmid#173481PurposeAn rrnB P1-based GFP ATP reporter in E. coliDepositorInsertGFP-mut2
UseSynthetic BiologyTagsssrA degradation tagExpressionBacterialPromoterrrnB P1Available SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
env8 reverse J1/13
Plasmid#99831PurposeGFPuv reporter that places expression of a fluorescent protein reporter (GFPuv) under control of the env8HyCbl riboswitch.DepositorInsertenv8 reverse J1/13
TagsGFPuvExpressionBacterialMutationJ1/13 sequence is reversedAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
env8 16nt J1/13
Plasmid#99832PurposeGFPuv reporter that places expression of a fluorescent protein reporter (GFPuv) under control of the env8HyCbl riboswitch.DepositorInsertenv8 16nt J1/13
TagsGFPuvExpressionBacterialMutationJ1/13 with 16 nucleotidesAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
env8 19nt J1/13
Plasmid#99834PurposeGFPuv reporter that places expression of a fluorescent protein reporter (GFPuv) under control of the env8HyCbl riboswitch.DepositorInsertenv8 19nt J1/13
TagsGFPuvExpressionBacterialMutationJ1/13 with 19 nucleotidesAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
env8 17nt J1/13
Plasmid#99833PurposeGFPuv reporter that places expression of a fluorescent protein reporter (GFPuv) under control of the env8HyCbl riboswitch.DepositorInsertenv8 17nt J1/13
TagsGFPuvExpressionBacterialMutationJ1/13 with 17 nucleotidesAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only