We narrowed to 720 results for: HL;
-
Plasmid#103878Purposefull-length human b2 with tension sensor at b2_743DepositorInsertfull-length human b2 with tension sensor at b2_743 (ITGB2 Human)
UseTagstension sensor moduleExpressionMutationPromoterAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorInsertd5-HT2BR gRNA1 (CG42796 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorInsertd5-HT2BR gRNA2 (CG42796 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT2AR(isoformD)-7xsfGFP11-HA-HDR-donor
Plasmid#221838PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsert7xGFP11-HA donor with 5-HT2AR (isoform D) homology arms
UseCRISPRTagsExpressionInsect and MammalianMutationPromoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT2AR(isoformBFH)-7xsfGFP11-HA-HDR-donor
Plasmid#221839PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsert7xGFP11-HA donor with 5-HT2AR (isoforms BFH) homology arms
UseCRISPRTagsExpressionInsect and MammalianMutationPromoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT2BR-7xGFP11-HA
Plasmid#221840PurposePlasmid for generating 10xUAS-5-HT2BR-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
KBB345
Plasmid#185078Purposerfa3D46 truncation fused to GFPDepositorInsertRFA3
UseTagsGFPExpressionYeastMutationRfa3 truncation aa 1-46PromoterAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB349
Plasmid#185080Purposerfa2D248 truncation fused to GFPDepositorInsertRFA2
UseTagsGFPExpressionYeastMutationRfa2 truncation aa 1-247PromoterAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHSE401
Plasmid#62201PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsgRNA scaffold
zCas9
UsePlant binary vectorTags3x FLAG and NLSExpressionPlantMutationmaize codon optimizedPromoter35S and AtU6-26pAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pet30b-5M SrtA
Plasmid#51140Purposeexpression plasmid for C-terminal his tagged S. aureus SrtA with enhanced catalytic activityDepositorInsertS.aureus SrtA 5M
UseTags6x HisExpressionBacterialMutationP94R, D160N, D165A, K190E, K196TPromoterT7Available SinceFeb. 24, 2014AvailabilityAcademic Institutions and Nonprofits only