We narrowed to 859 results for: control shrna
-
Plasmid#69584PurposeExpresses mutated p53-L344A tagged with mKate2 and split N-term mVenusDepositorInsertp53-L344A (TP53 Human)
UseLentiviralTagsmKate2 and split mVenus - N termExpressionMammalianMutationp53 L344A mutation that prevents tetramerization …PromoterEF1alphaAvailabilityAcademic Institutions and Nonprofits only -
pRRLHygro-pEF1a-p53ashL344A-mKate2-splitmVenusC
Plasmid#69585PurposeExpresses mutated p53-L344A tagged with mKate2 and split C-term mVenusDepositorInsertp53-L344A (TP53 Human)
UseLentiviralTagsmKate2 and split mVenus - C termExpressionMammalianMutationp53 L344A mutation that prevents tetramerization …PromoterEF1alphaAvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPU-huMDA5-miR30-L1221
Plasmid#174223PurposeAll-in-one huMDA5 rescue-control shRNA knockdown vectorDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgRNA(nt)-IM83
Plasmid#251969PurposeControl sgRNA with IM83 aptamer for yeast mtDNA editingDepositorInsertsgRNA(nt)-IM83
UseCRISPRExpressionYeastPromoterSNR52Available SinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSpyB-Tn7sg
Plasmid#248694PurposesgRNA expression vector - pBG35 promoter with Tn7sg negative control sgRNADepositorInsertTn7sg
ExpressionBacterialPromoterBG35Available SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
ptetgRNA-FRT
Plasmid#243872PurposesgRNA expression vector under tetR transcriptional control.DepositorInsertsgRNA_FRT
ExpressionBacterialAvailable SinceJan. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKDcas9 delta cerulean
Plasmid#230939Purposenon-targeting Reference Control; expresses mCeruleanDepositorInsertdCas9
UseCRISPRMutationadditional tetOAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKDcas9 delta mcherry
Plasmid#230940Purposenon-targeting Reference Control; expresses mCherryDepositorInsertdCas9
UseCRISPRMutationadditional tetOAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
BRD4-N CRISPR
Plasmid#140651PurposeBRD4 tagging CRISPRDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
sg_Trp53_i3-ipUSEPR-TR657
Plasmid#228929PurposeKnockdown of Trp53 in mammalian cellsDepositorInsertsg_Trp53_i3 (Trp53 Mouse)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
sg_Cdkn1a_i1-ipUSEPR-TR657
Plasmid#228953PurposeKnockdown of Cdkn1a in mammalian cellsDepositorInsertsg_Cdkn1a_i1 (Cdkn1a Mouse)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
sg_Cdkn1a_i2-ipUSEPR-TR657
Plasmid#228954PurposeKnockdown of Cdkn1a in mammalian cellsDepositorInsertsg_Cdkn1a_i2 (Cdkn1a Mouse)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-G6
Plasmid#73437PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant G6.DepositorInsertRepressor G6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3A2
Plasmid#73435PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3A2.DepositorInsertRepressor 3A2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-4A6
Plasmid#73434PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4A6.DepositorInsertRepressor 4A6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
LADL Bridge + Target Zfp462-Klf4SE
Plasmid#127668PurposeEncodes for CRY2-HA and mCherry proteins expressed from the EF1a promoter; 2 gRNAs targeting the Zfp462 promoter and 2 gRNAs targeting the Klf4 SE expressed from their individual hU6 promotersDepositorInsertCRY2-HA-2A-mCherry and gRNAs 129, 135, 115 and 117
UseCRISPRTagsHAExpressionMammalianPromoterEF1a and hU6Available SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-C4
Plasmid#73427PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant C4.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
gRNAs[bTub+Sxl].1046B
Plasmid#112692Purposeexpress two gRNA targeting bTub & Sxl under dU6-3 promoterDepositorInsertU6.3-gRNA[bTub] and U6.3-gRNA[Sxl] (Sxl Fly)
UseCRISPRAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3F2
Plasmid#73428PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3F2.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only