We narrowed to 9,648 results for: Ada;
-
Plasmid#159132PurposeExpresses BACH1 in mammalian cellsDepositorInsertBACH1 (BACH1 Human)
UseTags2X-FLAG _ 2X-STREPExpressionMammalianMutationY11FPromoterCMVAvailable sinceSept. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-H3C2
Plasmid#207783PurposeDonor template for moxGFP-2A-Puro insertion into the C-terminus of the H3C2 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 Addgene #207780DepositorInsertH3C2 Homology Arms flanking a moxGFP-Puro Cassette (H3C2 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
p2R3a-GUS-OcsT
Plasmid#71267PurposeEntry clone containing the GUS enzyme. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertBeta-glucuronidase
UseGatewayTags2xGly linker and octaline synthase terminatorExpressionMutationPromoterAvailable sinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_NPYmut
Plasmid#208679PurposeExpresses the genetically-encoded fluorescent neuropeptide Y (NPY) control sensor GRAB_NPYmut in neuronsDepositorInsertGPCR activation based neuropeptide Y (NPY) control sensor GRAB_NPYmut
UseAAVTagsExpressionMutationPromoterhSynAvailable sinceOct. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAVA-Gal11p-LGF2(fs)
Plasmid#127482PurposeNegative control for the AVA-seq system. Gal11p (lambda CI associated) and LGF2 (with one nucleotide insertion) (RNAp associated) interactionDepositorInsertGal11p-LGF2(frame shifted) (GAL11 Budding Yeast)
UseTagsExpressionBacterialMutationLGF2 is frame shifted by the insert of one nucleo…PromoterAvailable sinceNov. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
ApoE3_mCh-SspB (pBS1144)
Plasmid#185326PurposeFor the mammalian expression of the human protein ApoE3 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE3
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-SM
Plasmid#136578PurposeDox-inducible polycistronic lentiviral vector expressing mouse Sox2, cMycDepositorUseLentiviralTagsExpressionBacterialMutationPromotertetO-miniCMV (dox-inducible)Available sinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot7-D40AE42A_L
Plasmid#146890PurposeMammalian Expression of HsNot7-D40AE42A. Please note that this plasmid does not contain the T7 promoter.DepositorInsertHsNot7-D40AE42A (CNOT7 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
p-mCherry-C1-Aurora
Plasmid#98167Purposered-shifted artificial anion conducting channelrhodopsin (aACR). Activation up to 600 nm; off-kinetics 260 ms. Codon optimized for mammalian expression.DepositorInsertSynthetic construct Aurora gene
UseTagsmCherryExpressionMammalianMutationV59S, E83N, E90Q, E101S, V117R, E123S, P242R, A24…PromoterCMV (+enhancer)Available sinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBItetDT240GFP
Plasmid#96904Purposetet inducible bidirectional plasmid expressing GFP in one direction and in the other a human DMPK genomic segment containing exons 11-15 with 240 interrupted CTG repeats in exon 15 locatedDepositorInsertEGFP and human DMPK exons 11-15 with 240 interrupted CTG repeats (DMPK Human)
UseTetracycline responsive and bidirectionalTagsExpressionMammalianMutationPromotertetracycline responsive and bidirectionalAvailable sinceNov. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNCST-AvicFP4
Plasmid#129507PurposeExpresses AvicFP4 constitutively in E. coli (most strains)DepositorInsertAvicFP4
UseTagsExpressionBacterialMutationOne of two variants of AvicFP4 tested with essent…Promotersynthetic constitutive (stationary phase) promote…Available sinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLX307 DEDD
Plasmid#117744PurposeOpen reading frame vector encoding DEDDDepositorInsertDEDD1 (DEDD Human)
UseLentiviralTagsV5ExpressionMammalianMutationPromoterEF1aAvailable sinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTIGER_tdTomato::3xFLAG::dCrk
Plasmid#131138PurposeUASp construct for over-expression of Drosophila Crk with N-terminal tandem Tomato and 3X FLAG tag. Compatible with PhiC31-mediated site-specific integration or classical P-element insertion.DepositorInsertCrk (Crk Fly)
UseTags3XFLAG and tdTomatoExpressionInsectMutationPromoterAvailable sinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-TAF4B
Plasmid#192927PurposeBarcoded piggybac transposon vector with Dox-inducible expression of TAF4BDepositorInsertTAF4B (TAF4B Human)
UseTagsExpressionMammalianMutationPromoterTET3G-miniCMVAvailable sinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-sTagRFP-TUBA1B
Plasmid#207768PurposeDonor template for Blast-2A-sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Blast-sTagRFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCold I-Hero13
Plasmid#187929PurposeBacterial expression of heat-resistant obscure (Hero) protein Hero13DepositorInsertHero13 (BEX3 Human)
UseTagsFlag-6xHisExpressionBacterialMutationPromoterAvailable sinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKK-NoTag
Plasmid#105767PurposeControl vector for pKK series (encodes only SLIC arms (TEV-L and TEV-R)); expression without tag. Useful to design other vectors; any tag can be added.DepositorTypeEmpty backboneUseFlp-in competentTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
S1 1029 CP ABEMax strategy 1
Plasmid#135357PurposeExpression of circular permutant of nSpyCas9 at amino acid position 1029 encoding ABEMax (wildtype Tada monomer coupled with evolved Tada monomer) at the N-terminusDepositorInsertABEMax-nSpyCas9 aa 1029
UseCRISPRTagsExpressionMammalianMutationWTPromoterAvailable sinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
mP58.dJ1-pCDNA3
Plasmid#21884DepositorInsertP58 (Dnajc3 Mouse)
UseTagsExpressionMammalianMutationDnaJ domain deleted from C-termPromoterAvailable sinceSept. 14, 2009AvailabilityAcademic Institutions and Nonprofits only