We narrowed to 19,495 results for: INO
-
Plasmid#236431Purposetransient overexpression of E2F1 in mammalian cellsDepositorAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pRF+423Dux4
Plasmid#21625DepositorInsertDouble homeobox, chr 4 (DUX4 Human)
UseLuciferaseAvailable SinceJuly 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
pIRES proHB-EGF WT
Plasmid#11602DepositorInsertHB-EGF (HBEGF Human)
ExpressionMammalianAvailable SinceApril 26, 2006AvailabilityAcademic Institutions and Nonprofits only -
CIBN-CAAX
Plasmid#79574Purposeexpression of N-terminal portion of CIB1 with a C-terminal CAAX box from KRras for plasma-membrane targetingDepositorInsertCIBN (CIB1 Mustard Weed)
TagsC-terminal CAAX-boxExpressionMammalianMutationK93A, R94A, K106A, K107A (please see depositor co…PromoterCMVAvailable SinceJuly 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
Polymerase expression - pCMV-Phi29 (LM2708)
Plasmid#208965PurposeUnfused Phi29 DNA polymerase (-exo), expressed from CMV or T7 promoters.DepositorInsertPhi29-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationPhi29(-exo;D169A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
p8327 pLIX YAP1 S127A
Plasmid#184528PurposeExpression of YAP1 S127ADepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC-GFP-MCC
Plasmid#133307Purpose"Burdensome" GFP expressing plasmid carrying microcin-V bacteriocin for plasmid stabilisationDepositorInsertmicrocin-V bacteriocin cassette (cvaC E. coli)
UseSynthetic BiologyExpressionBacterialMutationN112D (please see depositors comments)Available SinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GFP-IRES-hSNCA
Plasmid#185715PurposeAAV expression of GFP and human α-Synuclein from hSyn promoterDepositorAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-TDP-43
Plasmid#190093PurposeExpresses TDP-43 in mammalian cells. Note: EGFP and TDP-43 are expressed in different reading frames.DepositorInsertTAR DNA-Binding Protein 43 (TARDBP Human)
ExpressionMammalianAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcS-RDG-C1C2
Plasmid#200163PurposeThis plasmid encodes non-binder control monobody (RDG) fused to the extracellular vesicle binding domain (C1C2) of lactadherin for surface engineering extracellular vesicles.DepositorInsertsRDG-C1C2
C1C2 domain of lactadherin
TagsHA and HISExpressionMammalianMutationsequence adopted from doi: 10.1371/journal.pone.0…Available SinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
iOn-CAG∞MCS
Plasmid#154013PurposeExpression vector based on the iOn integration-coupled transcriptional switch (Kumamoto et al bioRxiv 2019), equipped with an MCS to clone-in genes of interest and express it from a CAG promoterDepositorInsertMCS
ExpressionMammalianPromoterCAGAvailable SinceJuly 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pY108 (lenti-AsCpf1)
Plasmid#84739PurposeLenti virus delivery of AsCpf1 and crRNA guideDepositorInsertshuAsCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2APromoterEFSAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR-SFFV-dCas9-BFP
Plasmid#46910PurposeHuman expression vector containing SFFV promoter, dCas9 that is fused to 2x NLS and tagBFPDepositorInsertdCas9-BFP fusion
UseCRISPR and LentiviralTags2xNLS, BFP, and HAExpressionMammalianPromoterSFFVAvailable SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV5B-HA-Smad2
Plasmid#11734DepositorAvailable SinceAug. 3, 2006AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1994
Plasmid#49124PurposeAAV plasmid with S100B (Ple266) promoter driving expression of iCre.DepositorInsertssAAV-Ple266-iCre
UseAAVExpressionMammalianPromoterS100BAvailable SinceMay 6, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pY109 (lenti-LbCpf1)
Plasmid#84740PurposeLenti virus delivery of LbCpf1 and crRNA guideDepositorInsertshuLbCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2APromoterEFSAvailable SinceNov. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLPC-LaminA
Plasmid#69059Purposeencodes the LaminA-CS proteinDepositorAvailable SinceDec. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GFP-IRES-mSNCA
Plasmid#185714PurposeAAV expression of GFP and mouse α-Synuclein from hSyn promoterDepositorAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRK5-FLAG-FNIP2
Plasmid#72294PurposeoverexpressionDepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only