We narrowed to 10,144 results for: Uty
-
Plasmid#158790PurposepcDNA5 based transfection plasmid for the exogenous expression of N-terminal BirA-Flag-tagged eIF4G1 including the microexon for generation of N2A FlpIn cell lines for BioIDDepositorInserteIF4G1 (with microexon)
Tags3xFlag and BirA*ExpressionMammalianPromoterminiCMVAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno FT
Plasmid#101824PurposeAdenovirus for the expression of gRNAs targeting intron 17 of murine Fgfr3 and intron 6 of murine Tacc3DepositorUseAdenoviralTagsFLAG-Cas9PromoterU6 and CBhAvailable SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEMS1132
Plasmid#29053PurposeHigh copy homologous recombination plasmid for gene targeting at the mouse Hprt locus containing Ple67 (FEV MiniPromoter) driving an EGFP/Cre fusion reporterDepositorAvailable SinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pT/CAGGS-NRASG12V/D38A-IRES-mVenus
Plasmid#236077PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Caggs promotor driven expression of mVenus and a double mutant NRAS (NRASG12VD38A).DepositorInsertsUseSleeping beauty transposon plasmidMutationG12V D38APromoterCAGGSAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/CAGGS-NRASG12V-IRES-mVenus
Plasmid#236076PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Caggs promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidMutationG12VPromoterCAGGSAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/CAGGS-mVenus-P2A-NRASG12V
Plasmid#236072PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Caggs promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidMutationG12VPromoterCAGGSAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-CNDP2-E166D
Plasmid#226720PurposeMammalian expression of cytosolic mouse CNDP2 mutant E166DDepositorAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-CNDP2-E166L
Plasmid#226721PurposeMammalian expression of cytosolic mouse CNDP2 mutant E166LDepositorAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-CNDP2-D195A
Plasmid#226722PurposeMammalian expression of cytosolic mouse CNDP2 mutant D195ADepositorAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-CNDP2-H445F
Plasmid#226723PurposeMammalian expression of cytosolic mouse CNDP2 mutant H445FDepositorAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/UBC-mVenus-P2A-NRASG12V
Plasmid#236074PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Ubc promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidMutationG12VPromoterUbcAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/PGK-mVenus-P2A-NRASG12V
Plasmid#236073PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Pgk promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidMutationG12VPromoterPGKAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFC34K LgBiT TK-Neo Human collagen type IV alpha 5 chain (COL4A5)
Plasmid#229770PurposeHuman Col4A5 tagged at C-terminal with LgBiT to be used with C-tagged SmBiT hCol4A3 and Flag-tagged hCol4A4 in Nanobit assay systemDepositorAvailable SinceJan. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFC36K SmBiT TK-neo Human collagen type IV alpha 3 chain (COL4A3)
Plasmid#229769PurposeHuman Col4A3 tagged at C-terminal with SmBiT to be used with C-tagged LgBiT hCol4A5 and Flag-tagged hCol4A4 in Nanobit assay systemDepositorAvailable SinceDec. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFN33K LgBiT TK-neo Human collagen type IV alpha 5 chain (COL4A5)
Plasmid#229768PurposeHuman Col4A5 tagged at N-terminal with LgBiT to be used with N-tagged SmBiT hCol4A3 and Flag-tagged hCol4A4 in Nanobit assay systemDepositorAvailable SinceDec. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFN35K SmBiT TK-neo Human collagen type IV alpha 3 chain (COL4A3)
Plasmid#229767PurposeHuman Col4A3 tagged at N-terminal with SmBiT to be used with N-tagged LgBiT hCol4A5 and Flag-tagged hCol4A4 in Nanobit assay systemDepositorInsertHuman collagen type IV alpha 3 chain (COL4A3) (COL4A3 Human)
UseLuciferaseTagsSmBiTMutationSee Depositor CommentsAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
CRISPRoff-mScarletI
Plasmid#217783PurposeExpresses CRISPRoff-mScarletI (DNMT3A-DNMT3L-XTEN80-dCas9-HA-2xNLS-mScarletI-KRAB) downstream of the CAG promoter for gene epigenetic silencingDepositorInsertCRISPRoff-mScarletI (DNMT3A-DNMT3L-dCas9-mScarletI-KRAB)
Tags2xNLS, DNMT3A-DNMT3L, HA, KRAB, and mScarletIExpressionMammalianPromoterCAGAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
Gi2-CASE
Plasmid#168121PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein Gi2. Composed of the subunits G alpha i2 (GNAI2) tagged with NanoLuciferase, G beta 1 (GNB1) and Venus-tagged G gamma 2 (GNG2).DepositorUseLuciferaseTagscpVenus on GNG2ExpressionMammalianMutationNLuc is inserted at C112/E115 within GNAI2Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLX401-INK4A
Plasmid#121919PurposeDoxycycline-inducible expression of p16-INK4A product of CDKN2ADepositorAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only