We narrowed to 16,387 results for: LEA
-
Plasmid#198548PurposeExpresses human codon-optimized SpCas9-miniCGBE1 and blasticidin resistance: EFS promoter-SpCas9-miniCGBE1-NLS-FLAG-P2A-BSDDepositorInsertSpCas9-miniCGBE1
UseCRISPR and LentiviralTagsBSD, FLAG, and NLSExpressionMammalianPromoterEFSAvailable SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-NRRH
Plasmid#198540PurposeExpresses human codon-optimized SpCas9-NRRH and blasticidin resistance: EFS promoter-SpCas9-NRRH-NLS-FLAG-P2A-BSDDepositorInsertSpCas9-NRRH
UseCRISPR and LentiviralTagsBSD, FLAG, and NLSExpressionMammalianPromoterEFSAvailable SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-NRCH
Plasmid#198542PurposeExpresses human codon-optimized SpCas9-NRCH and blasticidin resistance: EFS promoter-SpCas9-NRCH-NLS-FLAG-P2A-BSDDepositorInsertSpCas9-NRCH
UseCRISPR and LentiviralTagsBSD, FLAG, and NLSExpressionMammalianPromoterEFSAvailable SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKM-U6-reRNA-mmSCN9A
Plasmid#205636PurposereRNA guide targeting Mus Musculus SCN9ADepositorAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMBS-853
Plasmid#218011PurposemCerulean fluorescent proteinDepositorInsertmCerulean
UseSynthetic BiologyAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMBS-861
Plasmid#218017PurposemCerulean fluorescent proteinDepositorInsertmCerulean
UseSynthetic BiologyAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACB143
Plasmid#222214PurposeFor recombinant expression of vanB (PP_3737 from Pseudomonas putida) with the A24P mutation and an N-terminal thrombin-cleavable His tagDepositorInsertvanB(A24P)
TagsN-terminal, thrombin-cleavable 6x His tagExpressionBacterialMutationChanged Alanine 24 to ProlinePromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETSUMO2_Ideonella-bGSDM-WELQ
Plasmid#222098PurposeFor expression of a mutant bacterial gasdermin (bGSDM) encoded by a Ideonella species with a WELQut protease cleavage site for controlled activation.DepositorInsertIdeonella-bGSDM-WELQ ORF
Tags6xHis-SUMO2ExpressionBacterialMutationN-terminal methionine deleted and replaced by sin…PromoterT7Available SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/T0-3XFLAG-NESm-NFATC2IP
Plasmid#221445PurposeMammalian expression vector of triple Flag tagged NFATC2IP ORF with mutant nuclear export signal (NESm) at N-terminusDepositorInsertNFATC2IP (NFATC2IP Human)
Tags3XFlag and Mutant Nuclear Export Signal (mNES)ExpressionMammalianMutationmutant NES (NESm: NLVDLQKKLEEAKADEQQ (PMID: 10739…PromoterCMVAvailable SinceJuly 3, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA5-FRT/T0-3XFLAG-NES-NFATC2IP
Plasmid#221444PurposeMammalian expression vector of triple Flag tagged NFATC2IP ORF with nuclear export signal (NES) at its N-terminusDepositorInsertNFATC2IP (NFATC2IP Human)
Tags3XFlag and Nuclear Export Signal (NES)ExpressionMammalianMutationNES (NLVDLQKKLEELELDEQQ)inserted, 1st Methionine …PromoterCMVAvailable SinceJuly 3, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pILGFPEasy9R
Plasmid#218291PurposePlasmid-free in-situ promoter cloning and characterisation system in S. cerevisiae, allows the characterisation of a bidirectional promoter using yEGFP and E2-Crimson as reporters.DepositorInsertpURA3>KlURA3>tKlURA3-tPGK1KanMX>tAgTEF-pMAL32>MazF(RPL28i)-E2Crimson>tPDC1-pDDI2>ISceI>tSynth3>ura3(4,191)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
TDP-43 mRuby K84ONBK
Plasmid#216226PurposeTDP-43 with a C-terminal mRuby tag and Lysine 84 in the NLS mutated to a TAG stop codon for amber codon suppression.DepositorInsertTransactive response DNA binding protein of 43 kDa (TARDBP Human)
ExpressionMammalianMutationLysine 84 mutated to a TAG stop codonPromoterCMV PromoterAvailable SinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMAT_M4_YVTM_YQNQ
Plasmid#197084PurposeThis plasmid contains the coding sequence for signaling peptide M4, which contains the YVTM and YQNQ signaling motifs. Digest this insert and add it to pHR_pSFFV_scFVCD19_CD8a_CD3zP2AEGFPDepositorInsertThis plasmid contains the coding sequence for signaling peptide M4, which contains the YVTM and YQNQ signaling motifs.
ExpressionMammalianAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMAT_M10_PQQAT
Plasmid#197093PurposeThis plasmid contains the coding sequence for signaling peptide M10, which contains the PQQAT signaling motif. Digest this insert and add it to pHR_pSFFV_scFVCD19_CD8a_CD3zP2AEGFPDepositorInsertThis plasmid contains the coding sequence for signaling peptide M10, which contains the PQQAT signaling motif.
ExpressionMammalianAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMAT_M11_PQEINF
Plasmid#197094PurposeThis plasmid contains the coding sequence for signaling peptide M11, which contains the PQEINF signaling motif. Digest this insert and add it to pHR_pSFFV_scFVCD19_CD8a_CD3zP2AEGFPDepositorInsertThis plasmid contains the coding sequence for signaling peptide M11, which contains the PQEINF signaling motif.
ExpressionMammalianAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMAT_M12_RPTAVEG
Plasmid#197095PurposeThis plasmid contains the coding sequence for signaling peptide M12, which contains the RPTAVEG signaling motif. Digest this insert and add it to pHR_pSFFV_scFVCD19_CD8a_CD3zP2AEGFPDepositorInsertThis plasmid contains the coding sequence for signaling peptide M12, which contains the RPTAVEG signaling motif.
ExpressionMammalianAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMAT_M13_6xSAG
Plasmid#197096PurposeThis plasmid contains the coding sequence for the control peptide M13, which contains a linker with six repeats of serine-alanine-glycine. Digest this insert and add it to pHR_pSFFV_scFVCD19_CD8a_CDepositorInsertControl peptide M13, which contains a linker with six repeats of serine-alanine-glycine (SAG)
ExpressionMammalianAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTY186 EGFP-T2A-ALFA-ORF6 SARS-CoV-2
Plasmid#204976PurposeCo-express EGFP and SARS-CoV-2 ORF6 N-terminally labeled with ALFA tagDepositorAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF702
Plasmid#209650PurposeSuicide plasmid carrying a neomycin resistance marker flanked by homologous regions of the Mth60-fimbria encoding operon of Methanothermobacter thermautotrophicusDepositorInsertsDownstream homologous region
thermostable neomycin phosphotransferase gene
Upstream homologous region
Available SinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only