We narrowed to 14,045 results for: crispr grnas
-
Plasmid#208545PurposeLentiviral vector expressing gRNA targeting human TAL1DepositorInsertTAL1(11) (TAL1 Human)
UseLentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(TAL1(12))-PGKpuro2ABFP-W
Plasmid#208546PurposeLentiviral vector expressing gRNA targeting human TAL1DepositorInsertTAL1(12) (TAL1 Human)
UseLentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(MRPS26(15))-PGKpuro2ABFP-W
Plasmid#200499PurposeLentiviral vector expressing gRNA targeting human MRPS26DepositorInsertMRPS26(15) (MRPS26 Human)
UseLentiviralAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(MRPS26(12))-PGKpuro2ABFP-W
Plasmid#200498PurposeLentiviral vector expressing gRNA targeting human MRPS26DepositorInsertMRPS26(12) (MRPS26 Human)
UseLentiviralAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(NDUFA1(12))-PGKpuro2ABFP-W
Plasmid#200495PurposeLentiviral vector expressing gRNA targeting human NDUFA1DepositorInsertNDUFA1(12) (NDUFA1 Human)
UseLentiviralAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(MRPL21(16))-PGKpuro2ABFP-W
Plasmid#200497PurposeLentiviral vector expressing gRNA targeting human MRPL21DepositorInsertMRPL21(16) (MRPL21 Human)
UseLentiviralAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(NDUFA1(11))-PGKpuro2ABFP-W
Plasmid#200494PurposeLentiviral vector expressing gRNA targeting human NDUFA1DepositorInsertNDUFA1(11) (NDUFA1 Human)
UseLentiviralAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(MRPL21(14))-PGKpuro2ABFP-W
Plasmid#200496PurposeLentiviral vector expressing gRNA targeting human MRPL21DepositorInsertMRPL21(14) (MRPL21 Human)
UseLentiviralAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
px335-sgRNA-EF(Cas9n)-mHdac1-L2
Plasmid#122307PurposeExpresses sgRNA targeting mouse Hdac1 and Cas9 nickase in mammalian cellsDepositorInsertsgRNA for mouse Hdac1 (Hdac1 Synthetic)
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSEM318 - sgRNA mosTI unc-119 single-copy
Plasmid#159822PurposeSingle copy or array insertion by MosTI using split unc-119 selectionDepositorInsertsgRNA mosTI unc-119 single-copy
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSEM320 - sgRNA mosTI unc-119 array insertion
Plasmid#159824PurposeSingle copy or array insertion by MosTI using split unc-119 selectionDepositorInsertsgRNA mosTI unc-119 array insertion
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEF1a_HH-EMX1 spacer-gRNA scaffold-EC73-5'-donor template-EC73-3'-HDV_pA_pCMV_EGFP-L138S-P2A-mCherry_pA
Plasmid#176459PurposeVector for expressing retron Ec73ncRNA-gRNA chimeric RNA (rgRNA) targeting EMX1 driven by EF1alpha promoter and and EGFP(L138S)-P2A-mCherry driven by CMVDepositorInsertHH-EMX1 spacer-gRNA scaffold-Ec73ncRNA-donor sequence-HDV
UseCRISPRExpressionMammalianPromoterEF1alphaAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEF1a_HH-HEK3 spacer-gRNA scaffold-EC73-5'-donor template-EC73-3'-HDV_pA_pCMV_EGFP-L138S-P2A-mCherry_pA
Plasmid#176460PurposeVector for expressing retron Ec73ncRNA-gRNA chimeric RNA (rgRNA) targeting HEK3 site driven by EF1alpha promoter and EGFP(L138S)-P2A-mCherry driven by CMVDepositorInsertHH-HEK3 spacer-gRNA scaffold-Ec73ncRNA-donor sequence-HDV
UseCRISPRExpressionMammalianPromoterEF1alphaAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-TargetBC-5xTAPE-1-pegRNA-InsertBC
Plasmid#183790PurposeA single construct out of the pool of plasmid for lineage recording experiment using DNA Ticker Tape.DepositorInsertsP2A-eGFP-TargetBC-5xTAPE-1
pegRNA-InsertBC
UseSynthetic BiologyMutationG>A in the gRNA scaffold- please see depositor…Available SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-2A-Puro-RAB7A-gRNA1 (PX459)
Plasmid#221551PurposeExpresses Cas9 and gRNA for disruption of Rab7A gene in human cellsDepositorAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro(PX459)-GJA1 sgRNA
Plasmid#164471PurposeExpresses sgRNA targeting human GJA1 locusDepositorAvailable SinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-2A-Puro-RAB7A-gRNA2 (PX459)
Plasmid#221552PurposeExpresses Cas9 and gRNA for disruption of Rab7A gene in human cellsDepositorAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
Pzac2.1 U6-control sgRNA1, 2, 3_gfaABC1D mcherry SV40
Plasmid#179120PurposeExpresses control sgRNAs under the U6 promoter and mcherry protein specifically in astrocytesDepositorInsertcontrol sgRNA
UseAAVPromoterU6Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
Pzac2.1 U6-Ezr sgRNA1, 2, 3_gfaABC1D mcherry SV40
Plasmid#179119PurposeExpresses Ezr sgRNAs under the U6 promoter and mcherry protein specifically in astrocytesDepositorInsertEzr sgRNA
UseAAVPromoterU6Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only