We narrowed to 7,281 results for: Tet-on
-
Plasmid#171845PurposeC. elegans mex-5 promoter (germline) driven dual fluorescent reporter for boxB tethering (eGFP) with boxB negative control (mCherry)DepositorInserthis-58, eGFP, mCherry
TagsN-terminal Tag OLLAS, V5 and C-terminal Tag PEST…ExpressionWormMutationboxB wild type and hairpin mutantPromotermex-5 promoterAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSW002-Pc-TorT(sp)
Plasmid#111255PurposeBroad host-range bacterial expression vector with constitutive Pc promoter followed by the E. coli TorT signal peptideDepositorInsertTorT signal peptide
ExpressionBacterialPromoterPcAvailable SinceJuly 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCD5-ss-D/bovine/France/5920/2014-HEFwtED-GCN4-sfGFP-ST
Plasmid#175017PurposeExpresses influenza D virus trimeric hemagglutinin esterase fusion protein fused to a sfGFPDepositorInsertOK-HEFwtED
TagsGCN4-TEV-sfGFP-TwinStrepExpressionMammalianPromoterCMVAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTPTP alpha (S204A)
Plasmid#17694DepositorAvailable SinceApril 24, 2008AvailabilityAcademic Institutions and Nonprofits only -
p5A1-Ti
Plasmid#92018PurposeExpresses TALE targeted to lac operator with 3 TEV cut sites in its repeat domain, anhydrotetracycline inducible catalytically inactive TEV proteaseDepositorInsertsTALE targeting lac operator with 3 TEV cleavage sites
Catalytically Inactive TEV Protease
UseTALENTags5x Arginine Tag, 6x His Tag, 7x His Tag, and FLAG…MutationS219V, C151AAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZS1[LacI-L]
Plasmid#60745PurposeContains PI driving expression dimeric LacI, the Lactose inducible repressor.DepositorInsertLacI
UseSynthetic BiologyExpressionBacterialMutationwt LacI without the tetramerization domainAvailable SinceAug. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
p5A7-T
Plasmid#92020PurposeExpresses TALE targeted to lac operator with one TEV cut site in its N-terminal domain and a second in the C-terminal domain, anhydrotetracycline inducible TEV proteaseDepositorInsertsTALE targeting lac operator with N and C-terminal TEV protease cleavage sites
Tobacco Etch Virus Protease
UseTALENTags5x Arginine Tag, 6x His Tag, 7x His Tag, and FLAG…MutationS219VAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
p5A3-T
Plasmid#92019PurposeExpresses TALE targeted to lac operator with one TEV cut site in its N-terminal domain, anhydrotetracycline inducible TEV proteaseDepositorInsertsTALE targeting lac operator with N-terminal TEV cleavage site
Tobacco Etch Virus Protease
UseTALENTags5x Arginine Tag, 6x His Tag, 7x His Tag, and FLAG…MutationS219VAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHL600
Plasmid#37563DepositorUseSynthetic BiologyExpressionBacterialPromoterpLlacO-1 and pLtetO-1Available SinceAug. 14, 2012AvailabilityAcademic Institutions and Nonprofits only -
GfaABC1D-Lck-mCherry-ibARK
Plasmid#241241PurposeExpression of plasma membrane-tethered ibARK in astrocytesDepositorInsertLck-mCherry-ibARK
UseAAVAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
mGreenLantern-[(A OR S) AND T] OR (C AND V)-SpyTag
Plasmid#243789PurposeExpresses multifunctional construct enabling the [AND/(OR)]OR(AND)-gated release of mGreenLantern from materials in response to sortase eSrtA(2A9), sortase eSrtA(4S9), TEV, HRV-3C, TEV and TVMV proteases. Construct contains a SpyTag for material tethering.DepositorInsertmGreenLantern
Tags6x His tag and SsrAExpressionBacterialAvailable SinceOct. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCK948
Plasmid#242917PurposeConstitutive expression of dCas9, MCP-TetD, and PspF-λN22DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKO025
Plasmid#242913PurposeaTc-inducible expression of Spy-dCas9-AsiA and Sth1-dCas9, and constitutive expression of MCP-SoxSDepositorInsertSth1-dCas9
UseCRISPR and Synthetic BiologyPromoterPtetAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-shControl-mCherry-CAAX
Plasmid#227689PurposeMembrane tethered mCherry and scramble of shRNA targeting Atg7DepositorInsertscrambled shRNA control
ExpressionMammalianAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mem-seTurboID
Plasmid#237888PurposeAAV vector encoding membrane-tethered seTurboID under the control of human synapsin promoterDepositorInsertmem-seTurboID
UseAAVTagsGAP43 palmitoylation signal and V5 tagExpressionMammalianPromoterhuman Synapsin 1 (hSyn)Available SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV CaMKII:RiboL1-jGCaMP8m
Plasmid#239668PurposeExpresses soma-targeted (ribosome tethered via RiboL1) jGCaMP8m under CaMKII promoter.DepositorInsertRiboL1-jGCaMP8m
UseAAVTags6xHis and RiboL1ExpressionMammalianPromoterCaMKIIAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV CaMKII:RiboL1-jGCaMP8s
Plasmid#239667PurposeExpresses soma-targeted (ribosome tethered via RiboL1) jGCaMP8s under CaMKII promoter.DepositorInsertRiboL1-jGCaMP8s
UseAAVTags6xHis and RiboL1ExpressionMammalianPromoterCaMKIIAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-NFHΔ36-72
Plasmid#232060PurposeExpresses construct for surface tethering: R. norvegicus NFH tail domain lacking residues 36-72DepositorInsertNeurofilament-Heavy tail domain lacking residues 36-72
Tags6xHisExpressionBacterialMutationadded N-terminal tryptophan and tyrosine, and cys…Available SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-NFHΔ462-638
Plasmid#232061PurposeExpresses construct for surface tethering: R. norvegicus NFH tail domain lacking residues 462-638DepositorInsertNeurofilament-Heavy tail domain lacking residues 462-638
Tags6xHisExpressionBacterialMutationadded N-terminal tryptophan and tyrosine, and cys…Available SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only